Variant Instance
This API endpoint handles listing (/variants) and retrieval (/variants/<ID>/) of genetic variants from the database
GET /api/variants/3638/?format=api
https://olida.ibsquare.be/api/variants/3638/relationships/in_combination?format=api", "related": "https://olida.ibsquare.be/api/variants/3638/combinations/?format=api" } }, "gene_name": { "links": { "self": "https://olida.ibsquare.be/api/variants/3638/relationships/gene_name?format=api", "related": "https://olida.ibsquare.be/api/variants/3638/gene/?format=api" }, "data": { "type": "Gene", "id": "IL21R" } }, "submitter": { "data": null }, "curator": { "data": null } }, "links": { "self": "https://olida.ibsquare.be/api/variants/3638/?format=api" } }, "meta": { "database_name": "OLIgogenic diseases DAtabase (OLIDA)", "resource_url": "olida.ibsquare.be", "api_release_year": "2021", "api_developer": [ [ "Arnau Dillen", "arnau.dillen@ulb.ac.be" ], [ "Charlotte Nachtegael", "charlotte.nachtegael@ulb.be" ] ], "api_version": "0.3", "api_maintainers": [ [ "Charlotte Nachtegael", "charlotte.nachtegael@ulb.be" ] ], "api_documentation": [ "olida.ibsquare.be/api/swagger", "olida.ibsquare.be/api/redoc" ], "copyright": "Copyright (c) 2025 · OLIDA All Rights Reserved.", "license": "CC Attribution-NonCommercial 4.0 International License", "ontologies": { "ORDO": "http://bioportal.bioontology.org/ontologies/ORDO", "GENO": "http://purl.obolibrary.org/obo/geno.owl", "MI": "http://purl.obolibrary.org/obo/mi.owl", "NCIT": "http://purl.obolibrary.org/obo/ncit.owl", "OGI": "http://purl.obolibrary.org/obo/ogi.owl", "OGG": "http://purl.obolibrary.org/obo/ogg.owl" }, "relevant_publications_doi": [ "10.1093/nar/gkv1068", "10.1093/database/baac023" ], "lastmodified": "2024-02-29T15:02:31.772988", "status": "CU", "curator": null, "submitter": "cnachteg" } }{ "data": { "type": "SmallVariant", "id": "3638", "attributes": { "frequencies": { "KGP_genomes_maf": null, "KGP_genomes_AFR_maf": null, "KGP_genomes_AMR_maf": null, "KGP_genomes_EAS_maf": null, "KGP_genomes_EUR_maf": null, "KGP_genomes_SAS_maf": null, "gnomad_maf": null, "gnomad_AFR_maf": null, "gnomad_AMR_maf": null, "gnomad_ASJ_maf": null, "gnomad_EAS_maf": null, "gnomad_FIN_maf": null, "gnomad_NFE_maf": null, "gnomad_OTH_maf": null, "gnomad_SAS_maf": null, "ESP_AA_maf": null, "ESP_EA_maf": null }, "predictions": { "sift_prediction": null, "pp2_hvar_prediction": null, "cadd_prediction": 1.965185, "mutationtaster_prediction": "Polymorphism" }, "status": null, "genomic_position_hg19": 27457410, "genomic_position_hg38": 27446089, "chromosome": "16", "annotation_flag": null, "ref_allele": "G", "alt_allele": "GTGAGCTCCCGACCCTGTGA", "cdna_change": "c.867+10_867+28dup", "protein_change": null, "transcript_id": null, "dbsnp_id": "NA", "variant_effect": null }, "relationships": { "in_combination": { "meta": { "count": 1 }, "data": [ { "type": "Combination", "id": "OLI1715" } ], "links": { "self": "