Variant List
This API endpoint handles listing (/variants) and retrieval (/variants/<ID>/) of genetic variants from the database
GET /api/genes/SMAD6/variants/?format=api
{ "data": [ { "type": "SmallVariant", "id": "1210", "attributes": { "frequencies": { "KGP_genomes_maf": null, "KGP_genomes_AFR_maf": null, "KGP_genomes_AMR_maf": null, "KGP_genomes_EAS_maf": null, "KGP_genomes_EUR_maf": null, "KGP_genomes_SAS_maf": null, "gnomad_maf": null, "gnomad_AFR_maf": null, "gnomad_AMR_maf": null, "gnomad_ASJ_maf": null, "gnomad_EAS_maf": null, "gnomad_FIN_maf": null, "gnomad_NFE_maf": null, "gnomad_OTH_maf": null, "gnomad_SAS_maf": null, "ESP_AA_maf": null, "ESP_EA_maf": null }, "predictions": { "sift_prediction": null, "pp2_hvar_prediction": null, "cadd_prediction": 5.854751, "mutationtaster_prediction": "Disease causing" }, "status": "CU", "genomic_position_hg19": 67073833, "genomic_position_hg38": 66781495, "chromosome": "15", "annotation_flag": "manually_attributed", "lastmodified": "2023-06-06T16:57:47.794992", "ref_allele": "G", "alt_allele": "GC", "cdna_change": "c.1455dupC", "protein_change": "p.Cys486LeufsTer79", "transcript_id": "NM_005585.4", "dbsnp_id": "NA", "variant_effect": "frameshift" }, "relationships": { "in_combination": { "meta": { "count": 1 }, "data": [ { "type": "Combination", "id": "OLI574" } ], "links": { "self": "https://olida.ibsquare.be/api/variants/1210/relationships/in_combination?format=api", "related": "https://olida.ibsquare.be/api/variants/1210/combinations/?format=api" } }, "gene_name": { "links": { "self": "https://olida.ibsquare.be/api/variants/1210/relationships/gene_name?format=api", "related": "https://olida.ibsquare.be/api/variants/1210/gene/?format=api" }, "data": { "type": "Gene", "id": "SMAD6" } } }, "links": { "self": "https://olida.ibsquare.be/api/variants/1210/?format=api" } }, { "type": "SmallVariant", "id": "2858", "attributes": { "frequencies": { "KGP_genomes_maf": null, "KGP_genomes_AFR_maf": null, "KGP_genomes_AMR_maf": null, "KGP_genomes_EAS_maf": null, "KGP_genomes_EUR_maf": null, "KGP_genomes_SAS_maf": null, "gnomad_maf": null, "gnomad_AFR_maf": null, "gnomad_AMR_maf": null, "gnomad_ASJ_maf": null, "gnomad_EAS_maf": null, "gnomad_FIN_maf": null, "gnomad_NFE_maf": null, "gnomad_OTH_maf": null, "gnomad_SAS_maf": null, "ESP_AA_maf": null, "ESP_EA_maf": null }, "predictions": { "sift_prediction": null, "pp2_hvar_prediction": null, "cadd_prediction": 4.612899, "mutationtaster_prediction": "Disease causing" }, "status": "CU", "genomic_position_hg19": 66995819, "genomic_position_hg38": 66703481, "chromosome": "15", "annotation_flag": null, "lastmodified": "2023-06-06T16:57:57.672417", "ref_allele": "CGAGGCGCCCAGGGCGCGGG", "alt_allele": "C", "cdna_change": null, "protein_change": null, "transcript_id": null, "dbsnp_id": "NA", "variant_effect": null }, "relationships": { "in_combination": { "meta": { "count": 1 }, "data": [ { "type": "Combination", "id": "OLI1358" } ], "links": { "self": "https://olida.ibsquare.be/api/variants/2858/relationships/in_combination?format=api", "related": "https://olida.ibsquare.be/api/variants/2858/combinations/?format=api" } }, "gene_name": { "links": { "self": "https://olida.ibsquare.be/api/variants/2858/relationships/gene_name?format=api", "related": "https://olida.ibsquare.be/api/variants/2858/gene/?format=api" }, "data": { "type": "Gene", "id": "SMAD6" } } }, "links": { "self": "https://olida.ibsquare.be/api/variants/2858/?format=api" } }, { "type": "SmallVariant", "id": "2859", "attributes": { "frequencies": { "KGP_genomes_maf": null, "KGP_genomes_AFR_maf": null, "KGP_genomes_AMR_maf": null, "KGP_genomes_EAS_maf": null, "KGP_genomes_EUR_maf": null, "KGP_genomes_SAS_maf": null, "gnomad_maf": null, "gnomad_AFR_maf": null, "gnomad_AMR_maf": null, "gnomad_ASJ_maf": null, "gnomad_EAS_maf": null, "gnomad_FIN_maf": null, "gnomad_NFE_maf": null, "gnomad_OTH_maf": null, "gnomad_SAS_maf": null, "ESP_AA_maf": null, "ESP_EA_maf": null }, "predictions": { "sift_prediction": null, "pp2_hvar_prediction": null, "cadd_prediction": 5.416852, "mutationtaster_prediction": "Disease causing" }, "status": "CU", "genomic_position_hg19": 67073415, "genomic_position_hg38": 66781077, "chromosome": "15", "annotation_flag": null, "lastmodified": "2023-06-06T16:57:57.678752", "ref_allele": "CG", "alt_allele": "C", "cdna_change": null, "protein_change": null, "transcript_id": null, "dbsnp_id": "NA", "variant_effect": null }, "relationships": { "in_combination": { "meta": { "count": 1 }, "data": [ { "type": "Combination", "id": "OLI1359" } ], "links": { "self": "https://olida.ibsquare.be/api/variants/2859/relationships/in_combination?format=api", "related": "https://olida.ibsquare.be/api/variants/2859/combinations/?format=api" } }, "gene_name": { "links": { "self": "https://olida.ibsquare.be/api/variants/2859/relationships/gene_name?format=api", "related": "https://olida.ibsquare.be/api/variants/2859/gene/?format=api" }, "data": { "type": "Gene", "id": "SMAD6" } } }, "links": { "self": "https://olida.ibsquare.be/api/variants/2859/?format=api" } }, { "type": "SmallVariant", "id": "2860", "attributes": { "frequencies": { "KGP_genomes_maf": null, "KGP_genomes_AFR_maf": null, "KGP_genomes_AMR_maf": null, "KGP_genomes_EAS_maf": null, "KGP_genomes_EUR_maf": null, "KGP_genomes_SAS_maf": null, "gnomad_maf": null, "gnomad_AFR_maf": null, "gnomad_AMR_maf": null, "gnomad_ASJ_maf": null, "gnomad_EAS_maf": null, "gnomad_FIN_maf": null, "gnomad_NFE_maf": null, "gnomad_OTH_maf": null, "gnomad_SAS_maf": null, "ESP_AA_maf": null, "ESP_EA_maf": null }, "predictions": { "sift_prediction": null, "pp2_hvar_prediction": null, "cadd_prediction": 5.125928, "mutationtaster_prediction": "Disease causing" }, "status": "CU", "genomic_position_hg19": 67073437, "genomic_position_hg38": 66781099, "chromosome": "15", "annotation_flag": null, "lastmodified": "2023-06-06T16:57:57.685003", "ref_allele": "A", "alt_allele": "AAT", "cdna_change": null, "protein_change": null, "transcript_id": null, "dbsnp_id": "NA", "variant_effect": null }, "relationships": { "in_combination": { "meta": { "count": 1 }, "data": [ { "type": "Combination", "id": "OLI1360" } ], "links": { "self": "https://olida.ibsquare.be/api/variants/2860/relationships/in_combination?format=api", "related": "https://olida.ibsquare.be/api/variants/2860/combinations/?format=api" } }, "gene_name": { "links": { "self": "https://olida.ibsquare.be/api/variants/2860/relationships/gene_name?format=api", "related": "https://olida.ibsquare.be/api/variants/2860/gene/?format=api" }, "data": { "type": "Gene", "id": "SMAD6" } } }, "links": { "self": "https://olida.ibsquare.be/api/variants/2860/?format=api" } }, { "type": "SmallVariant", "id": "2861", "attributes": { "frequencies": { "KGP_genomes_maf": null, "KGP_genomes_AFR_maf": null, "KGP_genomes_AMR_maf": null, "KGP_genomes_EAS_maf": null, "KGP_genomes_EUR_maf": null, "KGP_genomes_SAS_maf": null, "gnomad_maf": null, "gnomad_AFR_maf": null, "gnomad_AMR_maf": null, "gnomad_ASJ_maf": null, "gnomad_EAS_maf": null, "gnomad_FIN_maf": null, "gnomad_NFE_maf": null, "gnomad_OTH_maf": null, "gnomad_SAS_maf": null, "ESP_AA_maf": null, "ESP_EA_maf": null }, "predictions": { "sift_prediction": null, "pp2_hvar_prediction": null, "cadd_prediction": 5.304327, "mutationtaster_prediction": "Disease causing" }, "status": "CU", "genomic_position_hg19": 67004027, "genomic_position_hg38": 66711689, "chromosome": "15", "annotation_flag": null, "lastmodified": "2023-06-06T16:57:57.691160", "ref_allele": "C", "alt_allele": "CT", "cdna_change": null, "protein_change": null, "transcript_id": null, "dbsnp_id": "NA", "variant_effect": null }, "relationships": { "in_combination": { "meta": { "count": 1 }, "data": [ { "type": "Combination", "id": "OLI1361" } ], "links": { "self": "https://olida.ibsquare.be/api/variants/2861/relationships/in_combination?format=api", "related": "https://olida.ibsquare.be/api/variants/2861/combinations/?format=api" } }, "gene_name": { "links": { "self": "https://olida.ibsquare.be/api/variants/2861/relationships/gene_name?format=api", "related": "https://olida.ibsquare.be/api/variants/2861/gene/?format=api" }, "data": { "type": "Gene", "id": "SMAD6" } } }, "links": { "self": "https://olida.ibsquare.be/api/variants/2861/?format=api" } }, { "type": "SmallVariant", "id": "2862", "attributes": { "frequencies": { "KGP_genomes_maf": null, "KGP_genomes_AFR_maf": null, "KGP_genomes_AMR_maf": null, "KGP_genomes_EAS_maf": null, "KGP_genomes_EUR_maf": null, "KGP_genomes_SAS_maf": null, "gnomad_maf": null, "gnomad_AFR_maf": null, "gnomad_AMR_maf": null, "gnomad_ASJ_maf": null, "gnomad_EAS_maf": null, "gnomad_FIN_maf": null, "gnomad_NFE_maf": null, "gnomad_OTH_maf": null, "gnomad_SAS_maf": null, "ESP_AA_maf": null, "ESP_EA_maf": null }, "predictions": { "sift_prediction": "Tolerated", "pp2_hvar_prediction": "Benign", "cadd_prediction": 1.649384, "mutationtaster_prediction": "Polymorphism" }, "status": "CU", "genomic_position_hg19": 67008800, "genomic_position_hg38": 66716462, "chromosome": "15", "annotation_flag": null, "lastmodified": "2023-06-06T16:57:57.697620", "ref_allele": "A", "alt_allele": "G", "cdna_change": null, "protein_change": null, "transcript_id": null, "dbsnp_id": "NA", "variant_effect": null }, "relationships": { "in_combination": { "meta": { "count": 1 }, "data": [ { "type": "Combination", "id": "OLI1362" } ], "links": { "self": "https://olida.ibsquare.be/api/variants/2862/relationships/in_combination?format=api", "related": "https://olida.ibsquare.be/api/variants/2862/combinations/?format=api" } }, "gene_name": { "links": { "self": "https://olida.ibsquare.be/api/variants/2862/relationships/gene_name?format=api", "related": "https://olida.ibsquare.be/api/variants/2862/gene/?format=api" }, "data": { "type": "Gene", "id": "SMAD6" } } }, "links": { "self": "https://olida.ibsquare.be/api/variants/2862/?format=api" } }, { "type": "SmallVariant", "id": "2863", "attributes": { "frequencies": { "KGP_genomes_maf": null, "KGP_genomes_AFR_maf": null, "KGP_genomes_AMR_maf": null, "KGP_genomes_EAS_maf": null, "KGP_genomes_EUR_maf": null, "KGP_genomes_SAS_maf": null, "gnomad_maf": 8.283e-06, "gnomad_AFR_maf": 0.0, "gnomad_AMR_maf": 2.917e-05, "gnomad_ASJ_maf": 0.0, "gnomad_EAS_maf": 0.0, "gnomad_FIN_maf": 0.0, "gnomad_NFE_maf": 9.057e-06, "gnomad_OTH_maf": 0.0, "gnomad_SAS_maf": 0.0, "ESP_AA_maf": null, "ESP_EA_maf": null }, "predictions": { "sift_prediction": null, "pp2_hvar_prediction": null, "cadd_prediction": 8.769126, "mutationtaster_prediction": "Disease causing" }, "status": "CU", "genomic_position_hg19": 67073502, "genomic_position_hg38": 66781164, "chromosome": "15", "annotation_flag": null, "lastmodified": "2023-06-06T16:57:57.704046", "ref_allele": "G", "alt_allele": "T", "cdna_change": null, "protein_change": null, "transcript_id": null, "dbsnp_id": "NA", "variant_effect": null }, "relationships": { "in_combination": { "meta": { "count": 1 }, "data": [ { "type": "Combination", "id": "OLI1363" } ], "links": { "self": "https://olida.ibsquare.be/api/variants/2863/relationships/in_combination?format=api", "related": "https://olida.ibsquare.be/api/variants/2863/combinations/?format=api" } }, "gene_name": { "links": { "self": "https://olida.ibsquare.be/api/variants/2863/relationships/gene_name?format=api", "related": "https://olida.ibsquare.be/api/variants/2863/gene/?format=api" }, "data": { "type": "Gene", "id": "SMAD6" } } }, "links": { "self": "https://olida.ibsquare.be/api/variants/2863/?format=api" } }, { "type": "SmallVariant", "id": "2864", "attributes": { "frequencies": { "KGP_genomes_maf": null, "KGP_genomes_AFR_maf": null, "KGP_genomes_AMR_maf": null, "KGP_genomes_EAS_maf": null, "KGP_genomes_EUR_maf": null, "KGP_genomes_SAS_maf": null, "gnomad_maf": 0.0, "gnomad_AFR_maf": 0.0, "gnomad_AMR_maf": 0.0, "gnomad_ASJ_maf": 0.0, "gnomad_EAS_maf": 0.0, "gnomad_FIN_maf": 0.0, "gnomad_NFE_maf": 0.0, "gnomad_OTH_maf": 0.0, "gnomad_SAS_maf": 0.0, "ESP_AA_maf": null, "ESP_EA_maf": null }, "predictions": { "sift_prediction": null, "pp2_hvar_prediction": null, "cadd_prediction": 8.081697, "mutationtaster_prediction": "Disease causing" }, "status": "CU", "genomic_position_hg19": 66996263, "genomic_position_hg38": 66703925, "chromosome": "15", "annotation_flag": null, "lastmodified": "2023-06-06T16:57:57.710321", "ref_allele": "C", "alt_allele": "T", "cdna_change": null, "protein_change": null, "transcript_id": null, "dbsnp_id": "NA", "variant_effect": null }, "relationships": { "in_combination": { "meta": { "count": 1 }, "data": [ { "type": "Combination", "id": "OLI1364" } ], "links": { "self": "https://olida.ibsquare.be/api/variants/2864/relationships/in_combination?format=api", "related": "https://olida.ibsquare.be/api/variants/2864/combinations/?format=api" } }, "gene_name": { "links": { "self": "https://olida.ibsquare.be/api/variants/2864/relationships/gene_name?format=api", "related": "https://olida.ibsquare.be/api/variants/2864/gene/?format=api" }, "data": { "type": "Gene", "id": "SMAD6" } } }, "links": { "self": "https://olida.ibsquare.be/api/variants/2864/?format=api" } }, { "type": "SmallVariant", "id": "2865", "attributes": { "frequencies": { "KGP_genomes_maf": null, "KGP_genomes_AFR_maf": null, "KGP_genomes_AMR_maf": null, "KGP_genomes_EAS_maf": null, "KGP_genomes_EUR_maf": null, "KGP_genomes_SAS_maf": null, "gnomad_maf": 9.952e-06, "gnomad_AFR_maf": 0.0, "gnomad_AMR_maf": 3.168e-05, "gnomad_ASJ_maf": 0.0, "gnomad_EAS_maf": 0.0, "gnomad_FIN_maf": 0.0, "gnomad_NFE_maf": 1.101e-05, "gnomad_OTH_maf": 0.0, "gnomad_SAS_maf": 0.0, "ESP_AA_maf": null, "ESP_EA_maf": null }, "predictions": { "sift_prediction": "Tolerated", "pp2_hvar_prediction": "Benign", "cadd_prediction": 2.815779, "mutationtaster_prediction": "Disease causing" }, "status": "CU", "genomic_position_hg19": 67073350, "genomic_position_hg38": 66781012, "chromosome": "15", "annotation_flag": null, "lastmodified": "2023-06-06T16:57:57.716454", "ref_allele": "C", "alt_allele": "T", "cdna_change": null, "protein_change": null, "transcript_id": null, "dbsnp_id": "NA", "variant_effect": null }, "relationships": { "in_combination": { "meta": { "count": 1 }, "data": [ { "type": "Combination", "id": "OLI1365" } ], "links": { "self": "https://olida.ibsquare.be/api/variants/2865/relationships/in_combination?format=api", "related": "https://olida.ibsquare.be/api/variants/2865/combinations/?format=api" } }, "gene_name": { "links": { "self": "https://olida.ibsquare.be/api/variants/2865/relationships/gene_name?format=api", "related": "https://olida.ibsquare.be/api/variants/2865/gene/?format=api" }, "data": { "type": "Gene", "id": "SMAD6" } } }, "links": { "self": "https://olida.ibsquare.be/api/variants/2865/?format=api" } }, { "type": "SmallVariant", "id": "2866", "attributes": { "frequencies": { "KGP_genomes_maf": null, "KGP_genomes_AFR_maf": null, "KGP_genomes_AMR_maf": null, "KGP_genomes_EAS_maf": null, "KGP_genomes_EUR_maf": null, "KGP_genomes_SAS_maf": null, "gnomad_maf": 4.223e-06, "gnomad_AFR_maf": 0.0, "gnomad_AMR_maf": 0.0, "gnomad_ASJ_maf": 0.0, "gnomad_EAS_maf": 0.0, "gnomad_FIN_maf": 0.0, "gnomad_NFE_maf": 9.428e-06, "gnomad_OTH_maf": 0.0, "gnomad_SAS_maf": 0.0, "ESP_AA_maf": null, "ESP_EA_maf": null }, "predictions": { "sift_prediction": null, "pp2_hvar_prediction": null, "cadd_prediction": 8.321778, "mutationtaster_prediction": "Disease causing" }, "status": "CU", "genomic_position_hg19": 67073601, "genomic_position_hg38": 66781263, "chromosome": "15", "annotation_flag": null, "lastmodified": "2023-06-06T16:57:57.722693", "ref_allele": "G", "alt_allele": "T", "cdna_change": null, "protein_change": null, "transcript_id": null, "dbsnp_id": "NA", "variant_effect": null }, "relationships": { "in_combination": { "meta": { "count": 1 }, "data": [ { "type": "Combination", "id": "OLI1366" } ], "links": { "self": "https://olida.ibsquare.be/api/variants/2866/relationships/in_combination?format=api", "related": "https://olida.ibsquare.be/api/variants/2866/combinations/?format=api" } }, "gene_name": { "links": { "self": "https://olida.ibsquare.be/api/variants/2866/relationships/gene_name?format=api", "related": "https://olida.ibsquare.be/api/variants/2866/gene/?format=api" }, "data": { "type": "Gene", "id": "SMAD6" } } }, "links": { "self": "https://olida.ibsquare.be/api/variants/2866/?format=api" } }, { "type": "SmallVariant", "id": "2867", "attributes": { "frequencies": { "KGP_genomes_maf": null, "KGP_genomes_AFR_maf": null, "KGP_genomes_AMR_maf": null, "KGP_genomes_EAS_maf": null, "KGP_genomes_EUR_maf": null, "KGP_genomes_SAS_maf": null, "gnomad_maf": 5.619e-05, "gnomad_AFR_maf": 0.0, "gnomad_AMR_maf": 0.0003522, "gnomad_ASJ_maf": 0.0, "gnomad_EAS_maf": 5.685e-05, "gnomad_FIN_maf": 0.0, "gnomad_NFE_maf": 0.0, "gnomad_OTH_maf": 0.0, "gnomad_SAS_maf": 0.0, "ESP_AA_maf": null, "ESP_EA_maf": null }, "predictions": { "sift_prediction": "Deleterious", "pp2_hvar_prediction": "Damaging", "cadd_prediction": 4.336384, "mutationtaster_prediction": "Disease causing" }, "status": "CU", "genomic_position_hg19": 67073775, "genomic_position_hg38": 66781437, "chromosome": "15", "annotation_flag": null, "lastmodified": "2023-06-06T16:57:57.728793", "ref_allele": "C", "alt_allele": "T", "cdna_change": null, "protein_change": null, "transcript_id": null, "dbsnp_id": "NA", "variant_effect": null }, "relationships": { "in_combination": { "meta": { "count": 1 }, "data": [ { "type": "Combination", "id": "OLI1367" } ], "links": { "self": "https://olida.ibsquare.be/api/variants/2867/relationships/in_combination?format=api", "related": "https://olida.ibsquare.be/api/variants/2867/combinations/?format=api" } }, "gene_name": { "links": { "self": "https://olida.ibsquare.be/api/variants/2867/relationships/gene_name?format=api", "related": "https://olida.ibsquare.be/api/variants/2867/gene/?format=api" }, "data": { "type": "Gene", "id": "SMAD6" } } }, "links": { "self": "https://olida.ibsquare.be/api/variants/2867/?format=api" } }, { "type": "SmallVariant", "id": "2868", "attributes": { "frequencies": { "KGP_genomes_maf": null, "KGP_genomes_AFR_maf": null, "KGP_genomes_AMR_maf": null, "KGP_genomes_EAS_maf": null, "KGP_genomes_EUR_maf": null, "KGP_genomes_SAS_maf": null, "gnomad_maf": null, "gnomad_AFR_maf": null, "gnomad_AMR_maf": null, "gnomad_ASJ_maf": null, "gnomad_EAS_maf": null, "gnomad_FIN_maf": null, "gnomad_NFE_maf": null, "gnomad_OTH_maf": null, "gnomad_SAS_maf": null, "ESP_AA_maf": null, "ESP_EA_maf": null }, "predictions": { "sift_prediction": "Deleterious", "pp2_hvar_prediction": "Damaging", "cadd_prediction": 3.9693, "mutationtaster_prediction": "Disease causing" }, "status": "CU", "genomic_position_hg19": 67073851, "genomic_position_hg38": 66781513, "chromosome": "15", "annotation_flag": null, "lastmodified": "2023-06-06T16:57:57.734950", "ref_allele": "T", "alt_allele": "C", "cdna_change": null, "protein_change": null, "transcript_id": null, "dbsnp_id": "NA", "variant_effect": null }, "relationships": { "in_combination": { "meta": { "count": 1 }, "data": [ { "type": "Combination", "id": "OLI1368" } ], "links": { "self": "https://olida.ibsquare.be/api/variants/2868/relationships/in_combination?format=api", "related": "https://olida.ibsquare.be/api/variants/2868/combinations/?format=api" } }, "gene_name": { "links": { "self": "https://olida.ibsquare.be/api/variants/2868/relationships/gene_name?format=api", "related": "https://olida.ibsquare.be/api/variants/2868/gene/?format=api" }, "data": { "type": "Gene", "id": "SMAD6" } } }, "links": { "self": "https://olida.ibsquare.be/api/variants/2868/?format=api" } } ], "meta": { "database_name": "OLIgogenic diseases DAtabase (OLIDA)", "resource_url": "olida.ibsquare.be", "api_release_year": "2021", "api_developer": [ [ "Arnau Dillen", "arnau.dillen@ulb.ac.be" ], [ "Charlotte Nachtegael", "charlotte.nachtegael@ulb.be" ] ], "api_version": "0.3", "api_maintainers": [ [ "Charlotte Nachtegael", "charlotte.nachtegael@ulb.be" ] ], "api_documentation": [ "olida.ibsquare.be/api/swagger", "olida.ibsquare.be/api/redoc" ], "copyright": "Copyright (c) 2026 · OLIDA All Rights Reserved.", "license": "CC Attribution-NonCommercial 4.0 International License", "ontologies": { "ORDO": "http://bioportal.bioontology.org/ontologies/ORDO", "GENO": "http://purl.obolibrary.org/obo/geno.owl", "MI": "http://purl.obolibrary.org/obo/mi.owl", "NCIT": "http://purl.obolibrary.org/obo/ncit.owl", "OGI": "http://purl.obolibrary.org/obo/ogi.owl", "OGG": "http://purl.obolibrary.org/obo/ogg.owl" }, "relevant_publications_doi": [ "10.1093/nar/gkv1068", "10.1093/database/baac023" ], "Variant serializers": [ "SmallVariantSerializer", "CopyNumberVariantSerializer" ], "size": 12 } }