This API endpoint handles listing (/variants) and retrieval (/variants/<ID>/) of genetic variants from the database

GET /api/genes/SMAD6/variants/?format=api
HTTP 200 OK
Allow: GET, HEAD, OPTIONS
Content-Type: application/vnd.api+json
Vary: Accept

{
    "data": [
        {
            "type": "SmallVariant",
            "id": "1210",
            "attributes": {
                "frequencies": {
                    "KGP_genomes_maf": null,
                    "KGP_genomes_AFR_maf": null,
                    "KGP_genomes_AMR_maf": null,
                    "KGP_genomes_EAS_maf": null,
                    "KGP_genomes_EUR_maf": null,
                    "KGP_genomes_SAS_maf": null,
                    "gnomad_maf": null,
                    "gnomad_AFR_maf": null,
                    "gnomad_AMR_maf": null,
                    "gnomad_ASJ_maf": null,
                    "gnomad_EAS_maf": null,
                    "gnomad_FIN_maf": null,
                    "gnomad_NFE_maf": null,
                    "gnomad_OTH_maf": null,
                    "gnomad_SAS_maf": null,
                    "ESP_AA_maf": null,
                    "ESP_EA_maf": null
                },
                "predictions": {
                    "sift_prediction": null,
                    "pp2_hvar_prediction": null,
                    "cadd_prediction": 5.854751,
                    "mutationtaster_prediction": "Disease causing"
                },
                "status": "CU",
                "genomic_position_hg19": 67073833,
                "genomic_position_hg38": 66781495,
                "chromosome": "15",
                "annotation_flag": "manually_attributed",
                "lastmodified": "2023-06-06T16:57:47.794992",
                "ref_allele": "G",
                "alt_allele": "GC",
                "cdna_change": "c.1455dupC",
                "protein_change": "p.Cys486LeufsTer79",
                "transcript_id": "NM_005585.4",
                "dbsnp_id": "NA",
                "variant_effect": "frameshift"
            },
            "relationships": {
                "in_combination": {
                    "meta": {
                        "count": 1
                    },
                    "data": [
                        {
                            "type": "Combination",
                            "id": "OLI574"
                        }
                    ],
                    "links": {
                        "self": "https://olida.ibsquare.be/api/variants/1210/relationships/in_combination?format=api",
                        "related": "https://olida.ibsquare.be/api/variants/1210/combinations/?format=api"
                    }
                },
                "gene_name": {
                    "links": {
                        "self": "https://olida.ibsquare.be/api/variants/1210/relationships/gene_name?format=api",
                        "related": "https://olida.ibsquare.be/api/variants/1210/gene/?format=api"
                    },
                    "data": {
                        "type": "Gene",
                        "id": "SMAD6"
                    }
                }
            },
            "links": {
                "self": "https://olida.ibsquare.be/api/variants/1210/?format=api"
            }
        },
        {
            "type": "SmallVariant",
            "id": "2858",
            "attributes": {
                "frequencies": {
                    "KGP_genomes_maf": null,
                    "KGP_genomes_AFR_maf": null,
                    "KGP_genomes_AMR_maf": null,
                    "KGP_genomes_EAS_maf": null,
                    "KGP_genomes_EUR_maf": null,
                    "KGP_genomes_SAS_maf": null,
                    "gnomad_maf": null,
                    "gnomad_AFR_maf": null,
                    "gnomad_AMR_maf": null,
                    "gnomad_ASJ_maf": null,
                    "gnomad_EAS_maf": null,
                    "gnomad_FIN_maf": null,
                    "gnomad_NFE_maf": null,
                    "gnomad_OTH_maf": null,
                    "gnomad_SAS_maf": null,
                    "ESP_AA_maf": null,
                    "ESP_EA_maf": null
                },
                "predictions": {
                    "sift_prediction": null,
                    "pp2_hvar_prediction": null,
                    "cadd_prediction": 4.612899,
                    "mutationtaster_prediction": "Disease causing"
                },
                "status": "CU",
                "genomic_position_hg19": 66995819,
                "genomic_position_hg38": 66703481,
                "chromosome": "15",
                "annotation_flag": null,
                "lastmodified": "2023-06-06T16:57:57.672417",
                "ref_allele": "CGAGGCGCCCAGGGCGCGGG",
                "alt_allele": "C",
                "cdna_change": null,
                "protein_change": null,
                "transcript_id": null,
                "dbsnp_id": "NA",
                "variant_effect": null
            },
            "relationships": {
                "in_combination": {
                    "meta": {
                        "count": 1
                    },
                    "data": [
                        {
                            "type": "Combination",
                            "id": "OLI1358"
                        }
                    ],
                    "links": {
                        "self": "https://olida.ibsquare.be/api/variants/2858/relationships/in_combination?format=api",
                        "related": "https://olida.ibsquare.be/api/variants/2858/combinations/?format=api"
                    }
                },
                "gene_name": {
                    "links": {
                        "self": "https://olida.ibsquare.be/api/variants/2858/relationships/gene_name?format=api",
                        "related": "https://olida.ibsquare.be/api/variants/2858/gene/?format=api"
                    },
                    "data": {
                        "type": "Gene",
                        "id": "SMAD6"
                    }
                }
            },
            "links": {
                "self": "https://olida.ibsquare.be/api/variants/2858/?format=api"
            }
        },
        {
            "type": "SmallVariant",
            "id": "2859",
            "attributes": {
                "frequencies": {
                    "KGP_genomes_maf": null,
                    "KGP_genomes_AFR_maf": null,
                    "KGP_genomes_AMR_maf": null,
                    "KGP_genomes_EAS_maf": null,
                    "KGP_genomes_EUR_maf": null,
                    "KGP_genomes_SAS_maf": null,
                    "gnomad_maf": null,
                    "gnomad_AFR_maf": null,
                    "gnomad_AMR_maf": null,
                    "gnomad_ASJ_maf": null,
                    "gnomad_EAS_maf": null,
                    "gnomad_FIN_maf": null,
                    "gnomad_NFE_maf": null,
                    "gnomad_OTH_maf": null,
                    "gnomad_SAS_maf": null,
                    "ESP_AA_maf": null,
                    "ESP_EA_maf": null
                },
                "predictions": {
                    "sift_prediction": null,
                    "pp2_hvar_prediction": null,
                    "cadd_prediction": 5.416852,
                    "mutationtaster_prediction": "Disease causing"
                },
                "status": "CU",
                "genomic_position_hg19": 67073415,
                "genomic_position_hg38": 66781077,
                "chromosome": "15",
                "annotation_flag": null,
                "lastmodified": "2023-06-06T16:57:57.678752",
                "ref_allele": "CG",
                "alt_allele": "C",
                "cdna_change": null,
                "protein_change": null,
                "transcript_id": null,
                "dbsnp_id": "NA",
                "variant_effect": null
            },
            "relationships": {
                "in_combination": {
                    "meta": {
                        "count": 1
                    },
                    "data": [
                        {
                            "type": "Combination",
                            "id": "OLI1359"
                        }
                    ],
                    "links": {
                        "self": "https://olida.ibsquare.be/api/variants/2859/relationships/in_combination?format=api",
                        "related": "https://olida.ibsquare.be/api/variants/2859/combinations/?format=api"
                    }
                },
                "gene_name": {
                    "links": {
                        "self": "https://olida.ibsquare.be/api/variants/2859/relationships/gene_name?format=api",
                        "related": "https://olida.ibsquare.be/api/variants/2859/gene/?format=api"
                    },
                    "data": {
                        "type": "Gene",
                        "id": "SMAD6"
                    }
                }
            },
            "links": {
                "self": "https://olida.ibsquare.be/api/variants/2859/?format=api"
            }
        },
        {
            "type": "SmallVariant",
            "id": "2860",
            "attributes": {
                "frequencies": {
                    "KGP_genomes_maf": null,
                    "KGP_genomes_AFR_maf": null,
                    "KGP_genomes_AMR_maf": null,
                    "KGP_genomes_EAS_maf": null,
                    "KGP_genomes_EUR_maf": null,
                    "KGP_genomes_SAS_maf": null,
                    "gnomad_maf": null,
                    "gnomad_AFR_maf": null,
                    "gnomad_AMR_maf": null,
                    "gnomad_ASJ_maf": null,
                    "gnomad_EAS_maf": null,
                    "gnomad_FIN_maf": null,
                    "gnomad_NFE_maf": null,
                    "gnomad_OTH_maf": null,
                    "gnomad_SAS_maf": null,
                    "ESP_AA_maf": null,
                    "ESP_EA_maf": null
                },
                "predictions": {
                    "sift_prediction": null,
                    "pp2_hvar_prediction": null,
                    "cadd_prediction": 5.125928,
                    "mutationtaster_prediction": "Disease causing"
                },
                "status": "CU",
                "genomic_position_hg19": 67073437,
                "genomic_position_hg38": 66781099,
                "chromosome": "15",
                "annotation_flag": null,
                "lastmodified": "2023-06-06T16:57:57.685003",
                "ref_allele": "A",
                "alt_allele": "AAT",
                "cdna_change": null,
                "protein_change": null,
                "transcript_id": null,
                "dbsnp_id": "NA",
                "variant_effect": null
            },
            "relationships": {
                "in_combination": {
                    "meta": {
                        "count": 1
                    },
                    "data": [
                        {
                            "type": "Combination",
                            "id": "OLI1360"
                        }
                    ],
                    "links": {
                        "self": "https://olida.ibsquare.be/api/variants/2860/relationships/in_combination?format=api",
                        "related": "https://olida.ibsquare.be/api/variants/2860/combinations/?format=api"
                    }
                },
                "gene_name": {
                    "links": {
                        "self": "https://olida.ibsquare.be/api/variants/2860/relationships/gene_name?format=api",
                        "related": "https://olida.ibsquare.be/api/variants/2860/gene/?format=api"
                    },
                    "data": {
                        "type": "Gene",
                        "id": "SMAD6"
                    }
                }
            },
            "links": {
                "self": "https://olida.ibsquare.be/api/variants/2860/?format=api"
            }
        },
        {
            "type": "SmallVariant",
            "id": "2861",
            "attributes": {
                "frequencies": {
                    "KGP_genomes_maf": null,
                    "KGP_genomes_AFR_maf": null,
                    "KGP_genomes_AMR_maf": null,
                    "KGP_genomes_EAS_maf": null,
                    "KGP_genomes_EUR_maf": null,
                    "KGP_genomes_SAS_maf": null,
                    "gnomad_maf": null,
                    "gnomad_AFR_maf": null,
                    "gnomad_AMR_maf": null,
                    "gnomad_ASJ_maf": null,
                    "gnomad_EAS_maf": null,
                    "gnomad_FIN_maf": null,
                    "gnomad_NFE_maf": null,
                    "gnomad_OTH_maf": null,
                    "gnomad_SAS_maf": null,
                    "ESP_AA_maf": null,
                    "ESP_EA_maf": null
                },
                "predictions": {
                    "sift_prediction": null,
                    "pp2_hvar_prediction": null,
                    "cadd_prediction": 5.304327,
                    "mutationtaster_prediction": "Disease causing"
                },
                "status": "CU",
                "genomic_position_hg19": 67004027,
                "genomic_position_hg38": 66711689,
                "chromosome": "15",
                "annotation_flag": null,
                "lastmodified": "2023-06-06T16:57:57.691160",
                "ref_allele": "C",
                "alt_allele": "CT",
                "cdna_change": null,
                "protein_change": null,
                "transcript_id": null,
                "dbsnp_id": "NA",
                "variant_effect": null
            },
            "relationships": {
                "in_combination": {
                    "meta": {
                        "count": 1
                    },
                    "data": [
                        {
                            "type": "Combination",
                            "id": "OLI1361"
                        }
                    ],
                    "links": {
                        "self": "https://olida.ibsquare.be/api/variants/2861/relationships/in_combination?format=api",
                        "related": "https://olida.ibsquare.be/api/variants/2861/combinations/?format=api"
                    }
                },
                "gene_name": {
                    "links": {
                        "self": "https://olida.ibsquare.be/api/variants/2861/relationships/gene_name?format=api",
                        "related": "https://olida.ibsquare.be/api/variants/2861/gene/?format=api"
                    },
                    "data": {
                        "type": "Gene",
                        "id": "SMAD6"
                    }
                }
            },
            "links": {
                "self": "https://olida.ibsquare.be/api/variants/2861/?format=api"
            }
        },
        {
            "type": "SmallVariant",
            "id": "2862",
            "attributes": {
                "frequencies": {
                    "KGP_genomes_maf": null,
                    "KGP_genomes_AFR_maf": null,
                    "KGP_genomes_AMR_maf": null,
                    "KGP_genomes_EAS_maf": null,
                    "KGP_genomes_EUR_maf": null,
                    "KGP_genomes_SAS_maf": null,
                    "gnomad_maf": null,
                    "gnomad_AFR_maf": null,
                    "gnomad_AMR_maf": null,
                    "gnomad_ASJ_maf": null,
                    "gnomad_EAS_maf": null,
                    "gnomad_FIN_maf": null,
                    "gnomad_NFE_maf": null,
                    "gnomad_OTH_maf": null,
                    "gnomad_SAS_maf": null,
                    "ESP_AA_maf": null,
                    "ESP_EA_maf": null
                },
                "predictions": {
                    "sift_prediction": "Tolerated",
                    "pp2_hvar_prediction": "Benign",
                    "cadd_prediction": 1.649384,
                    "mutationtaster_prediction": "Polymorphism"
                },
                "status": "CU",
                "genomic_position_hg19": 67008800,
                "genomic_position_hg38": 66716462,
                "chromosome": "15",
                "annotation_flag": null,
                "lastmodified": "2023-06-06T16:57:57.697620",
                "ref_allele": "A",
                "alt_allele": "G",
                "cdna_change": null,
                "protein_change": null,
                "transcript_id": null,
                "dbsnp_id": "NA",
                "variant_effect": null
            },
            "relationships": {
                "in_combination": {
                    "meta": {
                        "count": 1
                    },
                    "data": [
                        {
                            "type": "Combination",
                            "id": "OLI1362"
                        }
                    ],
                    "links": {
                        "self": "https://olida.ibsquare.be/api/variants/2862/relationships/in_combination?format=api",
                        "related": "https://olida.ibsquare.be/api/variants/2862/combinations/?format=api"
                    }
                },
                "gene_name": {
                    "links": {
                        "self": "https://olida.ibsquare.be/api/variants/2862/relationships/gene_name?format=api",
                        "related": "https://olida.ibsquare.be/api/variants/2862/gene/?format=api"
                    },
                    "data": {
                        "type": "Gene",
                        "id": "SMAD6"
                    }
                }
            },
            "links": {
                "self": "https://olida.ibsquare.be/api/variants/2862/?format=api"
            }
        },
        {
            "type": "SmallVariant",
            "id": "2863",
            "attributes": {
                "frequencies": {
                    "KGP_genomes_maf": null,
                    "KGP_genomes_AFR_maf": null,
                    "KGP_genomes_AMR_maf": null,
                    "KGP_genomes_EAS_maf": null,
                    "KGP_genomes_EUR_maf": null,
                    "KGP_genomes_SAS_maf": null,
                    "gnomad_maf": 8.283e-06,
                    "gnomad_AFR_maf": 0.0,
                    "gnomad_AMR_maf": 2.917e-05,
                    "gnomad_ASJ_maf": 0.0,
                    "gnomad_EAS_maf": 0.0,
                    "gnomad_FIN_maf": 0.0,
                    "gnomad_NFE_maf": 9.057e-06,
                    "gnomad_OTH_maf": 0.0,
                    "gnomad_SAS_maf": 0.0,
                    "ESP_AA_maf": null,
                    "ESP_EA_maf": null
                },
                "predictions": {
                    "sift_prediction": null,
                    "pp2_hvar_prediction": null,
                    "cadd_prediction": 8.769126,
                    "mutationtaster_prediction": "Disease causing"
                },
                "status": "CU",
                "genomic_position_hg19": 67073502,
                "genomic_position_hg38": 66781164,
                "chromosome": "15",
                "annotation_flag": null,
                "lastmodified": "2023-06-06T16:57:57.704046",
                "ref_allele": "G",
                "alt_allele": "T",
                "cdna_change": null,
                "protein_change": null,
                "transcript_id": null,
                "dbsnp_id": "NA",
                "variant_effect": null
            },
            "relationships": {
                "in_combination": {
                    "meta": {
                        "count": 1
                    },
                    "data": [
                        {
                            "type": "Combination",
                            "id": "OLI1363"
                        }
                    ],
                    "links": {
                        "self": "https://olida.ibsquare.be/api/variants/2863/relationships/in_combination?format=api",
                        "related": "https://olida.ibsquare.be/api/variants/2863/combinations/?format=api"
                    }
                },
                "gene_name": {
                    "links": {
                        "self": "https://olida.ibsquare.be/api/variants/2863/relationships/gene_name?format=api",
                        "related": "https://olida.ibsquare.be/api/variants/2863/gene/?format=api"
                    },
                    "data": {
                        "type": "Gene",
                        "id": "SMAD6"
                    }
                }
            },
            "links": {
                "self": "https://olida.ibsquare.be/api/variants/2863/?format=api"
            }
        },
        {
            "type": "SmallVariant",
            "id": "2864",
            "attributes": {
                "frequencies": {
                    "KGP_genomes_maf": null,
                    "KGP_genomes_AFR_maf": null,
                    "KGP_genomes_AMR_maf": null,
                    "KGP_genomes_EAS_maf": null,
                    "KGP_genomes_EUR_maf": null,
                    "KGP_genomes_SAS_maf": null,
                    "gnomad_maf": 0.0,
                    "gnomad_AFR_maf": 0.0,
                    "gnomad_AMR_maf": 0.0,
                    "gnomad_ASJ_maf": 0.0,
                    "gnomad_EAS_maf": 0.0,
                    "gnomad_FIN_maf": 0.0,
                    "gnomad_NFE_maf": 0.0,
                    "gnomad_OTH_maf": 0.0,
                    "gnomad_SAS_maf": 0.0,
                    "ESP_AA_maf": null,
                    "ESP_EA_maf": null
                },
                "predictions": {
                    "sift_prediction": null,
                    "pp2_hvar_prediction": null,
                    "cadd_prediction": 8.081697,
                    "mutationtaster_prediction": "Disease causing"
                },
                "status": "CU",
                "genomic_position_hg19": 66996263,
                "genomic_position_hg38": 66703925,
                "chromosome": "15",
                "annotation_flag": null,
                "lastmodified": "2023-06-06T16:57:57.710321",
                "ref_allele": "C",
                "alt_allele": "T",
                "cdna_change": null,
                "protein_change": null,
                "transcript_id": null,
                "dbsnp_id": "NA",
                "variant_effect": null
            },
            "relationships": {
                "in_combination": {
                    "meta": {
                        "count": 1
                    },
                    "data": [
                        {
                            "type": "Combination",
                            "id": "OLI1364"
                        }
                    ],
                    "links": {
                        "self": "https://olida.ibsquare.be/api/variants/2864/relationships/in_combination?format=api",
                        "related": "https://olida.ibsquare.be/api/variants/2864/combinations/?format=api"
                    }
                },
                "gene_name": {
                    "links": {
                        "self": "https://olida.ibsquare.be/api/variants/2864/relationships/gene_name?format=api",
                        "related": "https://olida.ibsquare.be/api/variants/2864/gene/?format=api"
                    },
                    "data": {
                        "type": "Gene",
                        "id": "SMAD6"
                    }
                }
            },
            "links": {
                "self": "https://olida.ibsquare.be/api/variants/2864/?format=api"
            }
        },
        {
            "type": "SmallVariant",
            "id": "2865",
            "attributes": {
                "frequencies": {
                    "KGP_genomes_maf": null,
                    "KGP_genomes_AFR_maf": null,
                    "KGP_genomes_AMR_maf": null,
                    "KGP_genomes_EAS_maf": null,
                    "KGP_genomes_EUR_maf": null,
                    "KGP_genomes_SAS_maf": null,
                    "gnomad_maf": 9.952e-06,
                    "gnomad_AFR_maf": 0.0,
                    "gnomad_AMR_maf": 3.168e-05,
                    "gnomad_ASJ_maf": 0.0,
                    "gnomad_EAS_maf": 0.0,
                    "gnomad_FIN_maf": 0.0,
                    "gnomad_NFE_maf": 1.101e-05,
                    "gnomad_OTH_maf": 0.0,
                    "gnomad_SAS_maf": 0.0,
                    "ESP_AA_maf": null,
                    "ESP_EA_maf": null
                },
                "predictions": {
                    "sift_prediction": "Tolerated",
                    "pp2_hvar_prediction": "Benign",
                    "cadd_prediction": 2.815779,
                    "mutationtaster_prediction": "Disease causing"
                },
                "status": "CU",
                "genomic_position_hg19": 67073350,
                "genomic_position_hg38": 66781012,
                "chromosome": "15",
                "annotation_flag": null,
                "lastmodified": "2023-06-06T16:57:57.716454",
                "ref_allele": "C",
                "alt_allele": "T",
                "cdna_change": null,
                "protein_change": null,
                "transcript_id": null,
                "dbsnp_id": "NA",
                "variant_effect": null
            },
            "relationships": {
                "in_combination": {
                    "meta": {
                        "count": 1
                    },
                    "data": [
                        {
                            "type": "Combination",
                            "id": "OLI1365"
                        }
                    ],
                    "links": {
                        "self": "https://olida.ibsquare.be/api/variants/2865/relationships/in_combination?format=api",
                        "related": "https://olida.ibsquare.be/api/variants/2865/combinations/?format=api"
                    }
                },
                "gene_name": {
                    "links": {
                        "self": "https://olida.ibsquare.be/api/variants/2865/relationships/gene_name?format=api",
                        "related": "https://olida.ibsquare.be/api/variants/2865/gene/?format=api"
                    },
                    "data": {
                        "type": "Gene",
                        "id": "SMAD6"
                    }
                }
            },
            "links": {
                "self": "https://olida.ibsquare.be/api/variants/2865/?format=api"
            }
        },
        {
            "type": "SmallVariant",
            "id": "2866",
            "attributes": {
                "frequencies": {
                    "KGP_genomes_maf": null,
                    "KGP_genomes_AFR_maf": null,
                    "KGP_genomes_AMR_maf": null,
                    "KGP_genomes_EAS_maf": null,
                    "KGP_genomes_EUR_maf": null,
                    "KGP_genomes_SAS_maf": null,
                    "gnomad_maf": 4.223e-06,
                    "gnomad_AFR_maf": 0.0,
                    "gnomad_AMR_maf": 0.0,
                    "gnomad_ASJ_maf": 0.0,
                    "gnomad_EAS_maf": 0.0,
                    "gnomad_FIN_maf": 0.0,
                    "gnomad_NFE_maf": 9.428e-06,
                    "gnomad_OTH_maf": 0.0,
                    "gnomad_SAS_maf": 0.0,
                    "ESP_AA_maf": null,
                    "ESP_EA_maf": null
                },
                "predictions": {
                    "sift_prediction": null,
                    "pp2_hvar_prediction": null,
                    "cadd_prediction": 8.321778,
                    "mutationtaster_prediction": "Disease causing"
                },
                "status": "CU",
                "genomic_position_hg19": 67073601,
                "genomic_position_hg38": 66781263,
                "chromosome": "15",
                "annotation_flag": null,
                "lastmodified": "2023-06-06T16:57:57.722693",
                "ref_allele": "G",
                "alt_allele": "T",
                "cdna_change": null,
                "protein_change": null,
                "transcript_id": null,
                "dbsnp_id": "NA",
                "variant_effect": null
            },
            "relationships": {
                "in_combination": {
                    "meta": {
                        "count": 1
                    },
                    "data": [
                        {
                            "type": "Combination",
                            "id": "OLI1366"
                        }
                    ],
                    "links": {
                        "self": "https://olida.ibsquare.be/api/variants/2866/relationships/in_combination?format=api",
                        "related": "https://olida.ibsquare.be/api/variants/2866/combinations/?format=api"
                    }
                },
                "gene_name": {
                    "links": {
                        "self": "https://olida.ibsquare.be/api/variants/2866/relationships/gene_name?format=api",
                        "related": "https://olida.ibsquare.be/api/variants/2866/gene/?format=api"
                    },
                    "data": {
                        "type": "Gene",
                        "id": "SMAD6"
                    }
                }
            },
            "links": {
                "self": "https://olida.ibsquare.be/api/variants/2866/?format=api"
            }
        },
        {
            "type": "SmallVariant",
            "id": "2867",
            "attributes": {
                "frequencies": {
                    "KGP_genomes_maf": null,
                    "KGP_genomes_AFR_maf": null,
                    "KGP_genomes_AMR_maf": null,
                    "KGP_genomes_EAS_maf": null,
                    "KGP_genomes_EUR_maf": null,
                    "KGP_genomes_SAS_maf": null,
                    "gnomad_maf": 5.619e-05,
                    "gnomad_AFR_maf": 0.0,
                    "gnomad_AMR_maf": 0.0003522,
                    "gnomad_ASJ_maf": 0.0,
                    "gnomad_EAS_maf": 5.685e-05,
                    "gnomad_FIN_maf": 0.0,
                    "gnomad_NFE_maf": 0.0,
                    "gnomad_OTH_maf": 0.0,
                    "gnomad_SAS_maf": 0.0,
                    "ESP_AA_maf": null,
                    "ESP_EA_maf": null
                },
                "predictions": {
                    "sift_prediction": "Deleterious",
                    "pp2_hvar_prediction": "Damaging",
                    "cadd_prediction": 4.336384,
                    "mutationtaster_prediction": "Disease causing"
                },
                "status": "CU",
                "genomic_position_hg19": 67073775,
                "genomic_position_hg38": 66781437,
                "chromosome": "15",
                "annotation_flag": null,
                "lastmodified": "2023-06-06T16:57:57.728793",
                "ref_allele": "C",
                "alt_allele": "T",
                "cdna_change": null,
                "protein_change": null,
                "transcript_id": null,
                "dbsnp_id": "NA",
                "variant_effect": null
            },
            "relationships": {
                "in_combination": {
                    "meta": {
                        "count": 1
                    },
                    "data": [
                        {
                            "type": "Combination",
                            "id": "OLI1367"
                        }
                    ],
                    "links": {
                        "self": "https://olida.ibsquare.be/api/variants/2867/relationships/in_combination?format=api",
                        "related": "https://olida.ibsquare.be/api/variants/2867/combinations/?format=api"
                    }
                },
                "gene_name": {
                    "links": {
                        "self": "https://olida.ibsquare.be/api/variants/2867/relationships/gene_name?format=api",
                        "related": "https://olida.ibsquare.be/api/variants/2867/gene/?format=api"
                    },
                    "data": {
                        "type": "Gene",
                        "id": "SMAD6"
                    }
                }
            },
            "links": {
                "self": "https://olida.ibsquare.be/api/variants/2867/?format=api"
            }
        },
        {
            "type": "SmallVariant",
            "id": "2868",
            "attributes": {
                "frequencies": {
                    "KGP_genomes_maf": null,
                    "KGP_genomes_AFR_maf": null,
                    "KGP_genomes_AMR_maf": null,
                    "KGP_genomes_EAS_maf": null,
                    "KGP_genomes_EUR_maf": null,
                    "KGP_genomes_SAS_maf": null,
                    "gnomad_maf": null,
                    "gnomad_AFR_maf": null,
                    "gnomad_AMR_maf": null,
                    "gnomad_ASJ_maf": null,
                    "gnomad_EAS_maf": null,
                    "gnomad_FIN_maf": null,
                    "gnomad_NFE_maf": null,
                    "gnomad_OTH_maf": null,
                    "gnomad_SAS_maf": null,
                    "ESP_AA_maf": null,
                    "ESP_EA_maf": null
                },
                "predictions": {
                    "sift_prediction": "Deleterious",
                    "pp2_hvar_prediction": "Damaging",
                    "cadd_prediction": 3.9693,
                    "mutationtaster_prediction": "Disease causing"
                },
                "status": "CU",
                "genomic_position_hg19": 67073851,
                "genomic_position_hg38": 66781513,
                "chromosome": "15",
                "annotation_flag": null,
                "lastmodified": "2023-06-06T16:57:57.734950",
                "ref_allele": "T",
                "alt_allele": "C",
                "cdna_change": null,
                "protein_change": null,
                "transcript_id": null,
                "dbsnp_id": "NA",
                "variant_effect": null
            },
            "relationships": {
                "in_combination": {
                    "meta": {
                        "count": 1
                    },
                    "data": [
                        {
                            "type": "Combination",
                            "id": "OLI1368"
                        }
                    ],
                    "links": {
                        "self": "https://olida.ibsquare.be/api/variants/2868/relationships/in_combination?format=api",
                        "related": "https://olida.ibsquare.be/api/variants/2868/combinations/?format=api"
                    }
                },
                "gene_name": {
                    "links": {
                        "self": "https://olida.ibsquare.be/api/variants/2868/relationships/gene_name?format=api",
                        "related": "https://olida.ibsquare.be/api/variants/2868/gene/?format=api"
                    },
                    "data": {
                        "type": "Gene",
                        "id": "SMAD6"
                    }
                }
            },
            "links": {
                "self": "https://olida.ibsquare.be/api/variants/2868/?format=api"
            }
        }
    ],
    "meta": {
        "database_name": "OLIgogenic diseases DAtabase (OLIDA)",
        "resource_url": "olida.ibsquare.be",
        "api_release_year": "2021",
        "api_developer": [
            [
                "Arnau Dillen",
                "arnau.dillen@ulb.ac.be"
            ],
            [
                "Charlotte Nachtegael",
                "charlotte.nachtegael@ulb.be"
            ]
        ],
        "api_version": "0.3",
        "api_maintainers": [
            [
                "Charlotte Nachtegael",
                "charlotte.nachtegael@ulb.be"
            ]
        ],
        "api_documentation": [
            "olida.ibsquare.be/api/swagger",
            "olida.ibsquare.be/api/redoc"
        ],
        "copyright": "Copyright (c) 2026 · OLIDA All Rights Reserved.",
        "license": "CC Attribution-NonCommercial 4.0 International License",
        "ontologies": {
            "ORDO": "http://bioportal.bioontology.org/ontologies/ORDO",
            "GENO": "http://purl.obolibrary.org/obo/geno.owl",
            "MI": "http://purl.obolibrary.org/obo/mi.owl",
            "NCIT": "http://purl.obolibrary.org/obo/ncit.owl",
            "OGI": "http://purl.obolibrary.org/obo/ogi.owl",
            "OGG": "http://purl.obolibrary.org/obo/ogg.owl"
        },
        "relevant_publications_doi": [
            "10.1093/nar/gkv1068",
            "10.1093/database/baac023"
        ],
        "Variant serializers": [
            "SmallVariantSerializer",
            "CopyNumberVariantSerializer"
        ],
        "size": 12
    }
}