Variant List
This API endpoint handles listing (/variants) and retrieval (/variants/<ID>/) of genetic variants from the database
GET /api/genes/ANOS1/variants/?format=api
{ "data": [ { "type": "CopyNumberVariant", "id": "3399", "attributes": { "status": "CU", "genomic_position_hg19": null, "genomic_position_hg38": null, "chromosome": "X", "annotation_flag": "cnv", "lastmodified": "2023-12-20T14:11:25.443223", "location": "whole_gene", "sequence": "whole_gene", "number_of_repeats": null, "type_cnv": "deletion" }, "relationships": { "in_combination": { "meta": { "count": 1 }, "data": [ { "type": "Combination", "id": "OLI1415" } ], "links": { "self": "https://olida.ibsquare.be/api/variants/3399/relationships/in_combination?format=api", "related": "https://olida.ibsquare.be/api/variants/3399/combinations/?format=api" } }, "gene_name": { "data": { "type": "Gene", "id": "ANOS1" }, "links": { "related": "https://olida.ibsquare.be/api/genes/ANOS1/?format=api" } } }, "links": { "self": "https://olida.ibsquare.be/api/variants/3399/?format=api" } }, { "type": "CopyNumberVariant", "id": "1795", "attributes": { "status": "CU", "genomic_position_hg19": null, "genomic_position_hg38": null, "chromosome": "X", "annotation_flag": "cnv", "lastmodified": "2021-10-18T11:01:17.839282", "location": "exon1", "sequence": "exon1", "number_of_repeats": null, "type_cnv": "deletion" }, "relationships": { "in_combination": { "meta": { "count": 1 }, "data": [ { "type": "Combination", "id": "OLI814" } ], "links": { "self": "https://olida.ibsquare.be/api/variants/1795/relationships/in_combination?format=api", "related": "https://olida.ibsquare.be/api/variants/1795/combinations/?format=api" } }, "gene_name": { "data": { "type": "Gene", "id": "ANOS1" }, "links": { "related": "https://olida.ibsquare.be/api/genes/ANOS1/?format=api" } } }, "links": { "self": "https://olida.ibsquare.be/api/variants/1795/?format=api" } }, { "type": "CopyNumberVariant", "id": "1867", "attributes": { "status": "CU", "genomic_position_hg19": null, "genomic_position_hg38": null, "chromosome": "X", "annotation_flag": "cnv", "lastmodified": "2021-10-18T11:01:19.130050", "location": "exon9_14", "sequence": "exon9_14", "number_of_repeats": null, "type_cnv": "deletion" }, "relationships": { "in_combination": { "meta": { "count": 1 }, "data": [ { "type": "Combination", "id": "OLI853" } ], "links": { "self": "https://olida.ibsquare.be/api/variants/1867/relationships/in_combination?format=api", "related": "https://olida.ibsquare.be/api/variants/1867/combinations/?format=api" } }, "gene_name": { "data": { "type": "Gene", "id": "ANOS1" }, "links": { "related": "https://olida.ibsquare.be/api/genes/ANOS1/?format=api" } } }, "links": { "self": "https://olida.ibsquare.be/api/variants/1867/?format=api" } }, { "type": "SmallVariant", "id": "245", "attributes": { "frequencies": { "KGP_genomes_maf": null, "KGP_genomes_AFR_maf": null, "KGP_genomes_AMR_maf": null, "KGP_genomes_EAS_maf": null, "KGP_genomes_EUR_maf": null, "KGP_genomes_SAS_maf": null, "gnomad_maf": null, "gnomad_AFR_maf": null, "gnomad_AMR_maf": null, "gnomad_ASJ_maf": null, "gnomad_EAS_maf": null, "gnomad_FIN_maf": null, "gnomad_NFE_maf": null, "gnomad_OTH_maf": null, "gnomad_SAS_maf": null, "ESP_AA_maf": null, "ESP_EA_maf": null }, "predictions": { "sift_prediction": "Deleterious", "pp2_hvar_prediction": "Possibly Damaging", "cadd_prediction": 2.972345, "mutationtaster_prediction": "Disease causing" }, "status": "CU", "genomic_position_hg19": 8504893, "genomic_position_hg38": 8536852, "chromosome": "X", "annotation_flag": "automatically_attributed", "lastmodified": "2023-06-06T16:57:41.971426", "ref_allele": "C", "alt_allele": "T", "cdna_change": "c.1540G>A", "protein_change": "p.Glu514Lys", "transcript_id": "NM_000216.3", "dbsnp_id": "NA", "variant_effect": "missense" }, "relationships": { "in_combination": { "meta": { "count": 1 }, "data": [ { "type": "Combination", "id": "OLI119" } ], "links": { "self": "https://olida.ibsquare.be/api/variants/245/relationships/in_combination?format=api", "related": "https://olida.ibsquare.be/api/variants/245/combinations/?format=api" } }, "gene_name": { "links": { "self": "https://olida.ibsquare.be/api/variants/245/relationships/gene_name?format=api", "related": "https://olida.ibsquare.be/api/variants/245/gene/?format=api" }, "data": { "type": "Gene", "id": "ANOS1" } } }, "links": { "self": "https://olida.ibsquare.be/api/variants/245/?format=api" } }, { "type": "SmallVariant", "id": "309", "attributes": { "frequencies": { "KGP_genomes_maf": 0.0005, "KGP_genomes_AFR_maf": 0.0, "KGP_genomes_AMR_maf": 0.0038, "KGP_genomes_EAS_maf": 0.0, "KGP_genomes_EUR_maf": 0.0, "KGP_genomes_SAS_maf": 0.0, "gnomad_maf": 0.0002917, "gnomad_AFR_maf": 0.0, "gnomad_AMR_maf": 0.0003658, "gnomad_ASJ_maf": 0.004029, "gnomad_EAS_maf": 7.254e-05, "gnomad_FIN_maf": 6.303e-05, "gnomad_NFE_maf": 8.655e-05, "gnomad_OTH_maf": 0.0004446, "gnomad_SAS_maf": 0.0001064, "ESP_AA_maf": 0.0, "ESP_EA_maf": 0.0001486 }, "predictions": { "sift_prediction": "Deleterious", "pp2_hvar_prediction": "Benign", "cadd_prediction": 1.647021, "mutationtaster_prediction": "Disease causing" }, "status": "CU", "genomic_position_hg19": 8536293, "genomic_position_hg38": 8568252, "chromosome": "X", "annotation_flag": "automatically_attributed", "lastmodified": "2023-06-06T16:57:42.340083", "ref_allele": "G", "alt_allele": "A", "cdna_change": null, "protein_change": "p.Ser396Leu", "transcript_id": null, "dbsnp_id": "NA", "variant_effect": "missense" }, "relationships": { "in_combination": { "meta": { "count": 2 }, "data": [ { "type": "Combination", "id": "OLI152" }, { "type": "Combination", "id": "OLI205" } ], "links": { "self": "https://olida.ibsquare.be/api/variants/309/relationships/in_combination?format=api", "related": "https://olida.ibsquare.be/api/variants/309/combinations/?format=api" } }, "gene_name": { "links": { "self": "https://olida.ibsquare.be/api/variants/309/relationships/gene_name?format=api", "related": "https://olida.ibsquare.be/api/variants/309/gene/?format=api" }, "data": { "type": "Gene", "id": "ANOS1" } } }, "links": { "self": "https://olida.ibsquare.be/api/variants/309/?format=api" } }, { "type": "SmallVariant", "id": "399", "attributes": { "frequencies": { "KGP_genomes_maf": null, "KGP_genomes_AFR_maf": null, "KGP_genomes_AMR_maf": null, "KGP_genomes_EAS_maf": null, "KGP_genomes_EUR_maf": null, "KGP_genomes_SAS_maf": null, "gnomad_maf": null, "gnomad_AFR_maf": null, "gnomad_AMR_maf": null, "gnomad_ASJ_maf": null, "gnomad_EAS_maf": null, "gnomad_FIN_maf": null, "gnomad_NFE_maf": null, "gnomad_OTH_maf": null, "gnomad_SAS_maf": null, "ESP_AA_maf": null, "ESP_EA_maf": null }, "predictions": { "sift_prediction": null, "pp2_hvar_prediction": null, "cadd_prediction": 5.235575, "mutationtaster_prediction": "Disease causing" }, "status": "CU", "genomic_position_hg19": 8522080, "genomic_position_hg38": 8554039, "chromosome": "X", "annotation_flag": "automatically_attributed", "lastmodified": "2023-06-06T16:57:42.868330", "ref_allele": "G", "alt_allele": "A", "cdna_change": null, "protein_change": "p.Arg423Ter", "transcript_id": null, "dbsnp_id": "NA", "variant_effect": "nonsense" }, "relationships": { "in_combination": { "meta": { "count": 1 }, "data": [ { "type": "Combination", "id": "OLI206" } ], "links": { "self": "https://olida.ibsquare.be/api/variants/399/relationships/in_combination?format=api", "related": "https://olida.ibsquare.be/api/variants/399/combinations/?format=api" } }, "gene_name": { "links": { "self": "https://olida.ibsquare.be/api/variants/399/relationships/gene_name?format=api", "related": "https://olida.ibsquare.be/api/variants/399/gene/?format=api" }, "data": { "type": "Gene", "id": "ANOS1" } } }, "links": { "self": "https://olida.ibsquare.be/api/variants/399/?format=api" } }, { "type": "SmallVariant", "id": "559", "attributes": { "frequencies": { "KGP_genomes_maf": null, "KGP_genomes_AFR_maf": null, "KGP_genomes_AMR_maf": null, "KGP_genomes_EAS_maf": null, "KGP_genomes_EUR_maf": null, "KGP_genomes_SAS_maf": null, "gnomad_maf": null, "gnomad_AFR_maf": null, "gnomad_AMR_maf": null, "gnomad_ASJ_maf": null, "gnomad_EAS_maf": null, "gnomad_FIN_maf": null, "gnomad_NFE_maf": null, "gnomad_OTH_maf": null, "gnomad_SAS_maf": null, "ESP_AA_maf": null, "ESP_EA_maf": null }, "predictions": { "sift_prediction": "Deleterious", "pp2_hvar_prediction": "Damaging", "cadd_prediction": 3.058102, "mutationtaster_prediction": null }, "status": "CU", "genomic_position_hg19": 8555912, "genomic_position_hg38": 8587871, "chromosome": "X", "annotation_flag": "automatically_attributed", "lastmodified": "2023-06-06T16:57:43.796571", "ref_allele": "A", "alt_allele": "C", "cdna_change": null, "protein_change": "p.Tyr217Asp", "transcript_id": null, "dbsnp_id": "NA", "variant_effect": "missense" }, "relationships": { "in_combination": { "meta": { "count": 1 }, "data": [ { "type": "Combination", "id": "OLI289" } ], "links": { "self": "https://olida.ibsquare.be/api/variants/559/relationships/in_combination?format=api", "related": "https://olida.ibsquare.be/api/variants/559/combinations/?format=api" } }, "gene_name": { "links": { "self": "https://olida.ibsquare.be/api/variants/559/relationships/gene_name?format=api", "related": "https://olida.ibsquare.be/api/variants/559/gene/?format=api" }, "data": { "type": "Gene", "id": "ANOS1" } } }, "links": { "self": "https://olida.ibsquare.be/api/variants/559/?format=api" } }, { "type": "SmallVariant", "id": "777", "attributes": { "frequencies": { "KGP_genomes_maf": null, "KGP_genomes_AFR_maf": null, "KGP_genomes_AMR_maf": null, "KGP_genomes_EAS_maf": null, "KGP_genomes_EUR_maf": null, "KGP_genomes_SAS_maf": null, "gnomad_maf": null, "gnomad_AFR_maf": null, "gnomad_AMR_maf": null, "gnomad_ASJ_maf": null, "gnomad_EAS_maf": null, "gnomad_FIN_maf": null, "gnomad_NFE_maf": null, "gnomad_OTH_maf": null, "gnomad_SAS_maf": null, "ESP_AA_maf": null, "ESP_EA_maf": null }, "predictions": { "sift_prediction": null, "pp2_hvar_prediction": null, "cadd_prediction": 7.525869, "mutationtaster_prediction": "Disease causing" }, "status": "CU", "genomic_position_hg19": 8503708, "genomic_position_hg38": 8535667, "chromosome": "X", "annotation_flag": "automatically_attributed", "lastmodified": "2023-06-06T16:57:45.155514", "ref_allele": "C", "alt_allele": "T", "cdna_change": null, "protein_change": "p.Trp589Ter", "transcript_id": null, "dbsnp_id": "NA", "variant_effect": "nonsense" }, "relationships": { "in_combination": { "meta": { "count": 2 }, "data": [ { "type": "Combination", "id": "OLI355" }, { "type": "Combination", "id": "OLI876" } ], "links": { "self": "https://olida.ibsquare.be/api/variants/777/relationships/in_combination?format=api", "related": "https://olida.ibsquare.be/api/variants/777/combinations/?format=api" } }, "gene_name": { "links": { "self": "https://olida.ibsquare.be/api/variants/777/relationships/gene_name?format=api", "related": "https://olida.ibsquare.be/api/variants/777/gene/?format=api" }, "data": { "type": "Gene", "id": "ANOS1" } } }, "links": { "self": "https://olida.ibsquare.be/api/variants/777/?format=api" } }, { "type": "SmallVariant", "id": "849", "attributes": { "frequencies": { "KGP_genomes_maf": 0.0011, "KGP_genomes_AFR_maf": 0.0, "KGP_genomes_AMR_maf": 0.0057, "KGP_genomes_EAS_maf": 0.0, "KGP_genomes_EUR_maf": 0.0013, "KGP_genomes_SAS_maf": 0.0, "gnomad_maf": 0.002237, "gnomad_AFR_maf": 0.0006083, "gnomad_AMR_maf": 0.0008024, "gnomad_ASJ_maf": 0.008549, "gnomad_EAS_maf": 0.0, "gnomad_FIN_maf": 0.000125, "gnomad_NFE_maf": 0.003718, "gnomad_OTH_maf": 0.00221, "gnomad_SAS_maf": 0.0, "ESP_AA_maf": 0.0005215, "ESP_EA_maf": 0.003867 }, "predictions": { "sift_prediction": "Tolerated", "pp2_hvar_prediction": "Damaging", "cadd_prediction": 3.055541, "mutationtaster_prediction": "Polymorphism" }, "status": "CU", "genomic_position_hg19": 8503715, "genomic_position_hg38": 8535674, "chromosome": "X", "annotation_flag": "automatically_attributed", "lastmodified": "2023-06-06T16:57:45.581187", "ref_allele": "C", "alt_allele": "A", "cdna_change": "c.1759G>T", "protein_change": "p.Val587Leu", "transcript_id": "NM_000216.3", "dbsnp_id": "NA", "variant_effect": "missense" }, "relationships": { "in_combination": { "meta": { "count": 2 }, "data": [ { "type": "Combination", "id": "OLI1391" }, { "type": "Combination", "id": "OLI391" } ], "links": { "self": "https://olida.ibsquare.be/api/variants/849/relationships/in_combination?format=api", "related": "https://olida.ibsquare.be/api/variants/849/combinations/?format=api" } }, "gene_name": { "links": { "self": "https://olida.ibsquare.be/api/variants/849/relationships/gene_name?format=api", "related": "https://olida.ibsquare.be/api/variants/849/gene/?format=api" }, "data": { "type": "Gene", "id": "ANOS1" } } }, "links": { "self": "https://olida.ibsquare.be/api/variants/849/?format=api" } }, { "type": "SmallVariant", "id": "855", "attributes": { "frequencies": { "KGP_genomes_maf": null, "KGP_genomes_AFR_maf": null, "KGP_genomes_AMR_maf": null, "KGP_genomes_EAS_maf": null, "KGP_genomes_EUR_maf": null, "KGP_genomes_SAS_maf": null, "gnomad_maf": null, "gnomad_AFR_maf": null, "gnomad_AMR_maf": null, "gnomad_ASJ_maf": null, "gnomad_EAS_maf": null, "gnomad_FIN_maf": null, "gnomad_NFE_maf": null, "gnomad_OTH_maf": null, "gnomad_SAS_maf": null, "ESP_AA_maf": null, "ESP_EA_maf": null }, "predictions": { "sift_prediction": null, "pp2_hvar_prediction": null, "cadd_prediction": 5.880848, "mutationtaster_prediction": "Disease causing" }, "status": "CU", "genomic_position_hg19": 8555990, "genomic_position_hg38": 8587949, "chromosome": "X", "annotation_flag": "automatically_attributed", "lastmodified": "2023-06-06T16:57:45.620406", "ref_allele": "G", "alt_allele": "A", "cdna_change": "c.571C>T", "protein_change": "p.Arg191Ter", "transcript_id": "NM_000216.3", "dbsnp_id": "NA", "variant_effect": "nonsense" }, "relationships": { "in_combination": { "meta": { "count": 2 }, "data": [ { "type": "Combination", "id": "OLI1398" }, { "type": "Combination", "id": "OLI395" } ], "links": { "self": "https://olida.ibsquare.be/api/variants/855/relationships/in_combination?format=api", "related": "https://olida.ibsquare.be/api/variants/855/combinations/?format=api" } }, "gene_name": { "links": { "self": "https://olida.ibsquare.be/api/variants/855/relationships/gene_name?format=api", "related": "https://olida.ibsquare.be/api/variants/855/gene/?format=api" }, "data": { "type": "Gene", "id": "ANOS1" } } }, "links": { "self": "https://olida.ibsquare.be/api/variants/855/?format=api" } }, { "type": "SmallVariant", "id": "973", "attributes": { "frequencies": { "KGP_genomes_maf": null, "KGP_genomes_AFR_maf": null, "KGP_genomes_AMR_maf": null, "KGP_genomes_EAS_maf": null, "KGP_genomes_EUR_maf": null, "KGP_genomes_SAS_maf": null, "gnomad_maf": null, "gnomad_AFR_maf": null, "gnomad_AMR_maf": null, "gnomad_ASJ_maf": null, "gnomad_EAS_maf": null, "gnomad_FIN_maf": null, "gnomad_NFE_maf": null, "gnomad_OTH_maf": null, "gnomad_SAS_maf": null, "ESP_AA_maf": null, "ESP_EA_maf": null }, "predictions": { "sift_prediction": "Deleterious", "pp2_hvar_prediction": "Benign", "cadd_prediction": 1.070096, "mutationtaster_prediction": "Disease causing" }, "status": "CU", "genomic_position_hg19": 8507740, "genomic_position_hg38": 8539699, "chromosome": "X", "annotation_flag": "automatically_attributed", "lastmodified": "2023-06-06T16:57:46.352059", "ref_allele": "T", "alt_allele": "C", "cdna_change": "c.1464A>G", "protein_change": "p.Thr472Ala", "transcript_id": null, "dbsnp_id": "NA", "variant_effect": "missense" }, "relationships": { "in_combination": { "meta": { "count": 2 }, "data": [ { "type": "Combination", "id": "OLI456" }, { "type": "Combination", "id": "OLI498" } ], "links": { "self": "https://olida.ibsquare.be/api/variants/973/relationships/in_combination?format=api", "related": "https://olida.ibsquare.be/api/variants/973/combinations/?format=api" } }, "gene_name": { "links": { "self": "https://olida.ibsquare.be/api/variants/973/relationships/gene_name?format=api", "related": "https://olida.ibsquare.be/api/variants/973/gene/?format=api" }, "data": { "type": "Gene", "id": "ANOS1" } } }, "links": { "self": "https://olida.ibsquare.be/api/variants/973/?format=api" } }, { "type": "SmallVariant", "id": "975", "attributes": { "frequencies": { "KGP_genomes_maf": null, "KGP_genomes_AFR_maf": null, "KGP_genomes_AMR_maf": null, "KGP_genomes_EAS_maf": null, "KGP_genomes_EUR_maf": null, "KGP_genomes_SAS_maf": null, "gnomad_maf": 0.001638, "gnomad_AFR_maf": 0.0, "gnomad_AMR_maf": 0.0, "gnomad_ASJ_maf": 0.03363, "gnomad_EAS_maf": 0.0, "gnomad_FIN_maf": 0.0, "gnomad_NFE_maf": 0.0004194, "gnomad_OTH_maf": 0.003098, "gnomad_SAS_maf": 0.0, "ESP_AA_maf": 0.0, "ESP_EA_maf": 0.002676 }, "predictions": { "sift_prediction": "Tolerated", "pp2_hvar_prediction": "Benign", "cadd_prediction": 0.423979, "mutationtaster_prediction": "Polymorphism" }, "status": "CU", "genomic_position_hg19": 8503847, "genomic_position_hg38": 8535806, "chromosome": "X", "annotation_flag": "automatically_attributed", "lastmodified": "2023-06-06T16:57:46.364993", "ref_allele": "C", "alt_allele": "T", "cdna_change": "c.1627G>A", "protein_change": "p.Val543Ile", "transcript_id": "NM_000216.3", "dbsnp_id": "NA", "variant_effect": "missense" }, "relationships": { "in_combination": { "meta": { "count": 1 }, "data": [ { "type": "Combination", "id": "OLI457" } ], "links": { "self": "https://olida.ibsquare.be/api/variants/975/relationships/in_combination?format=api", "related": "https://olida.ibsquare.be/api/variants/975/combinations/?format=api" } }, "gene_name": { "links": { "self": "https://olida.ibsquare.be/api/variants/975/relationships/gene_name?format=api", "related": "https://olida.ibsquare.be/api/variants/975/gene/?format=api" }, "data": { "type": "Gene", "id": "ANOS1" } } }, "links": { "self": "https://olida.ibsquare.be/api/variants/975/?format=api" } }, { "type": "SmallVariant", "id": "1083", "attributes": { "frequencies": { "KGP_genomes_maf": null, "KGP_genomes_AFR_maf": null, "KGP_genomes_AMR_maf": null, "KGP_genomes_EAS_maf": null, "KGP_genomes_EUR_maf": null, "KGP_genomes_SAS_maf": null, "gnomad_maf": null, "gnomad_AFR_maf": null, "gnomad_AMR_maf": null, "gnomad_ASJ_maf": null, "gnomad_EAS_maf": null, "gnomad_FIN_maf": null, "gnomad_NFE_maf": null, "gnomad_OTH_maf": null, "gnomad_SAS_maf": null, "ESP_AA_maf": null, "ESP_EA_maf": null }, "predictions": { "sift_prediction": null, "pp2_hvar_prediction": null, "cadd_prediction": 1.533817, "mutationtaster_prediction": "Disease causing" }, "status": "CU", "genomic_position_hg19": 8565122, "genomic_position_hg38": 8597081, "chromosome": "X", "annotation_flag": "manually_corrected", "lastmodified": "2023-06-06T16:57:47.025271", "ref_allele": "GAAC", "alt_allele": "G", "cdna_change": "c.488_490delGTT", "protein_change": "p.Cys164del", "transcript_id": "NM_000216.4", "dbsnp_id": "NA", "variant_effect": "deletion" }, "relationships": { "in_combination": { "meta": { "count": 1 }, "data": [ { "type": "Combination", "id": "OLI511" } ], "links": { "self": "https://olida.ibsquare.be/api/variants/1083/relationships/in_combination?format=api", "related": "https://olida.ibsquare.be/api/variants/1083/combinations/?format=api" } }, "gene_name": { "links": { "self": "https://olida.ibsquare.be/api/variants/1083/relationships/gene_name?format=api", "related": "https://olida.ibsquare.be/api/variants/1083/gene/?format=api" }, "data": { "type": "Gene", "id": "ANOS1" } } }, "links": { "self": "https://olida.ibsquare.be/api/variants/1083/?format=api" } }, { "type": "SmallVariant", "id": "1832", "attributes": { "frequencies": { "KGP_genomes_maf": null, "KGP_genomes_AFR_maf": null, "KGP_genomes_AMR_maf": null, "KGP_genomes_EAS_maf": null, "KGP_genomes_EUR_maf": null, "KGP_genomes_SAS_maf": null, "gnomad_maf": null, "gnomad_AFR_maf": null, "gnomad_AMR_maf": null, "gnomad_ASJ_maf": null, "gnomad_EAS_maf": null, "gnomad_FIN_maf": null, "gnomad_NFE_maf": null, "gnomad_OTH_maf": null, "gnomad_SAS_maf": null, "ESP_AA_maf": null, "ESP_EA_maf": null }, "predictions": { "sift_prediction": "Deleterious", "pp2_hvar_prediction": "Damaging", "cadd_prediction": 2.934306, "mutationtaster_prediction": null }, "status": "CU", "genomic_position_hg19": 8503820, "genomic_position_hg38": 8535779, "chromosome": "X", "annotation_flag": "automatically_attributed", "lastmodified": "2023-06-06T16:57:51.573566", "ref_allele": "C", "alt_allele": "T", "cdna_change": "c.1654G>A", "protein_change": "p.Glu552Lys", "transcript_id": "NM_000216.3", "dbsnp_id": "NA", "variant_effect": "missense" }, "relationships": { "in_combination": { "meta": { "count": 2 }, "data": [ { "type": "Combination", "id": "OLI1344" }, { "type": "Combination", "id": "OLI837" } ], "links": { "self": "https://olida.ibsquare.be/api/variants/1832/relationships/in_combination?format=api", "related": "https://olida.ibsquare.be/api/variants/1832/combinations/?format=api" } }, "gene_name": { "links": { "self": "https://olida.ibsquare.be/api/variants/1832/relationships/gene_name?format=api", "related": "https://olida.ibsquare.be/api/variants/1832/gene/?format=api" }, "data": { "type": "Gene", "id": "ANOS1" } } }, "links": { "self": "https://olida.ibsquare.be/api/variants/1832/?format=api" } }, { "type": "SmallVariant", "id": "1833", "attributes": { "frequencies": { "KGP_genomes_maf": null, "KGP_genomes_AFR_maf": null, "KGP_genomes_AMR_maf": null, "KGP_genomes_EAS_maf": null, "KGP_genomes_EUR_maf": null, "KGP_genomes_SAS_maf": null, "gnomad_maf": null, "gnomad_AFR_maf": null, "gnomad_AMR_maf": null, "gnomad_ASJ_maf": null, "gnomad_EAS_maf": null, "gnomad_FIN_maf": null, "gnomad_NFE_maf": null, "gnomad_OTH_maf": null, "gnomad_SAS_maf": null, "ESP_AA_maf": null, "ESP_EA_maf": null }, "predictions": { "sift_prediction": null, "pp2_hvar_prediction": null, "cadd_prediction": 4.063691, "mutationtaster_prediction": "Disease causing" }, "status": "CU", "genomic_position_hg19": 8538539, "genomic_position_hg38": 8570498, "chromosome": "X", "annotation_flag": "manually_attributed", "lastmodified": "2023-06-06T16:57:51.580125", "ref_allele": "C", "alt_allele": "T", "cdna_change": "c.1062+1G>A", "protein_change": null, "transcript_id": "NM_000216.4", "dbsnp_id": "NA", "variant_effect": "splicing" }, "relationships": { "in_combination": { "meta": { "count": 2 }, "data": [ { "type": "Combination", "id": "OLI1344" }, { "type": "Combination", "id": "OLI837" } ], "links": { "self": "https://olida.ibsquare.be/api/variants/1833/relationships/in_combination?format=api", "related": "https://olida.ibsquare.be/api/variants/1833/combinations/?format=api" } }, "gene_name": { "links": { "self": "https://olida.ibsquare.be/api/variants/1833/relationships/gene_name?format=api", "related": "https://olida.ibsquare.be/api/variants/1833/gene/?format=api" }, "data": { "type": "Gene", "id": "ANOS1" } } }, "links": { "self": "https://olida.ibsquare.be/api/variants/1833/?format=api" } }, { "type": "SmallVariant", "id": "1863", "attributes": { "frequencies": { "KGP_genomes_maf": 0.0008, "KGP_genomes_AFR_maf": 0.0, "KGP_genomes_AMR_maf": 0.0, "KGP_genomes_EAS_maf": 0.0039, "KGP_genomes_EUR_maf": 0.0, "KGP_genomes_SAS_maf": 0.0, "gnomad_maf": 0.0008671, "gnomad_AFR_maf": 0.0, "gnomad_AMR_maf": 7.292e-05, "gnomad_ASJ_maf": 0.0, "gnomad_EAS_maf": 0.01111, "gnomad_FIN_maf": 6.246e-05, "gnomad_NFE_maf": 0.0, "gnomad_OTH_maf": 0.0, "gnomad_SAS_maf": 0.0001048, "ESP_AA_maf": null, "ESP_EA_maf": null }, "predictions": { "sift_prediction": "Tolerated", "pp2_hvar_prediction": "Benign", "cadd_prediction": 0.028984, "mutationtaster_prediction": "Polymorphism" }, "status": "CU", "genomic_position_hg19": 8503796, "genomic_position_hg38": 8535755, "chromosome": "X", "annotation_flag": "automatically_attributed", "lastmodified": "2023-06-06T16:57:51.774891", "ref_allele": "C", "alt_allele": "T", "cdna_change": "c.1678G>A", "protein_change": "p.Val560Ile", "transcript_id": "NM_000216.3", "dbsnp_id": "NA", "variant_effect": "missense" }, "relationships": { "in_combination": { "meta": { "count": 2 }, "data": [ { "type": "Combination", "id": "OLI852" }, { "type": "Combination", "id": "OLI856" } ], "links": { "self": "https://olida.ibsquare.be/api/variants/1863/relationships/in_combination?format=api", "related": "https://olida.ibsquare.be/api/variants/1863/combinations/?format=api" } }, "gene_name": { "links": { "self": "https://olida.ibsquare.be/api/variants/1863/relationships/gene_name?format=api", "related": "https://olida.ibsquare.be/api/variants/1863/gene/?format=api" }, "data": { "type": "Gene", "id": "ANOS1" } } }, "links": { "self": "https://olida.ibsquare.be/api/variants/1863/?format=api" } }, { "type": "SmallVariant", "id": "1876", "attributes": { "frequencies": { "KGP_genomes_maf": null, "KGP_genomes_AFR_maf": null, "KGP_genomes_AMR_maf": null, "KGP_genomes_EAS_maf": null, "KGP_genomes_EUR_maf": null, "KGP_genomes_SAS_maf": null, "gnomad_maf": null, "gnomad_AFR_maf": null, "gnomad_AMR_maf": null, "gnomad_ASJ_maf": null, "gnomad_EAS_maf": null, "gnomad_FIN_maf": null, "gnomad_NFE_maf": null, "gnomad_OTH_maf": null, "gnomad_SAS_maf": null, "ESP_AA_maf": null, "ESP_EA_maf": null }, "predictions": { "sift_prediction": null, "pp2_hvar_prediction": null, "cadd_prediction": 5.692657, "mutationtaster_prediction": "Disease causing" }, "status": "CU", "genomic_position_hg19": 8699945, "genomic_position_hg38": 8731904, "chromosome": "X", "annotation_flag": "automatically_attributed", "lastmodified": "2023-06-06T16:57:51.846468", "ref_allele": "G", "alt_allele": "A", "cdna_change": "c.133C>T", "protein_change": "p.Gln45Ter", "transcript_id": "NM_000216.3", "dbsnp_id": "NA", "variant_effect": "nonsense" }, "relationships": { "in_combination": { "meta": { "count": 1 }, "data": [ { "type": "Combination", "id": "OLI857" } ], "links": { "self": "https://olida.ibsquare.be/api/variants/1876/relationships/in_combination?format=api", "related": "https://olida.ibsquare.be/api/variants/1876/combinations/?format=api" } }, "gene_name": { "links": { "self": "https://olida.ibsquare.be/api/variants/1876/relationships/gene_name?format=api", "related": "https://olida.ibsquare.be/api/variants/1876/gene/?format=api" }, "data": { "type": "Gene", "id": "ANOS1" } } }, "links": { "self": "https://olida.ibsquare.be/api/variants/1876/?format=api" } }, { "type": "SmallVariant", "id": "1927", "attributes": { "frequencies": { "KGP_genomes_maf": null, "KGP_genomes_AFR_maf": null, "KGP_genomes_AMR_maf": null, "KGP_genomes_EAS_maf": null, "KGP_genomes_EUR_maf": null, "KGP_genomes_SAS_maf": null, "gnomad_maf": null, "gnomad_AFR_maf": null, "gnomad_AMR_maf": null, "gnomad_ASJ_maf": null, "gnomad_EAS_maf": null, "gnomad_FIN_maf": null, "gnomad_NFE_maf": null, "gnomad_OTH_maf": null, "gnomad_SAS_maf": null, "ESP_AA_maf": null, "ESP_EA_maf": null }, "predictions": { "sift_prediction": null, "pp2_hvar_prediction": null, "cadd_prediction": 4.05841, "mutationtaster_prediction": "Disease causing" }, "status": "CU", "genomic_position_hg19": 8521993, "genomic_position_hg38": 8553952, "chromosome": "X", "annotation_flag": "manually_corrected", "lastmodified": "2023-06-06T16:57:52.172140", "ref_allele": "CT", "alt_allele": "C", "cdna_change": "c.1353del", "protein_change": "p.Asp452IlefsTer30", "transcript_id": "NM_000216.2", "dbsnp_id": "NA", "variant_effect": "frameshift" }, "relationships": { "in_combination": { "meta": { "count": 1 }, "data": [ { "type": "Combination", "id": "OLI885" } ], "links": { "self": "https://olida.ibsquare.be/api/variants/1927/relationships/in_combination?format=api", "related": "https://olida.ibsquare.be/api/variants/1927/combinations/?format=api" } }, "gene_name": { "links": { "self": "https://olida.ibsquare.be/api/variants/1927/relationships/gene_name?format=api", "related": "https://olida.ibsquare.be/api/variants/1927/gene/?format=api" }, "data": { "type": "Gene", "id": "ANOS1" } } }, "links": { "self": "https://olida.ibsquare.be/api/variants/1927/?format=api" } }, { "type": "SmallVariant", "id": "2202", "attributes": { "frequencies": { "KGP_genomes_maf": null, "KGP_genomes_AFR_maf": null, "KGP_genomes_AMR_maf": null, "KGP_genomes_EAS_maf": null, "KGP_genomes_EUR_maf": null, "KGP_genomes_SAS_maf": null, "gnomad_maf": null, "gnomad_AFR_maf": null, "gnomad_AMR_maf": null, "gnomad_ASJ_maf": null, "gnomad_EAS_maf": null, "gnomad_FIN_maf": null, "gnomad_NFE_maf": null, "gnomad_OTH_maf": null, "gnomad_SAS_maf": null, "ESP_AA_maf": null, "ESP_EA_maf": null }, "predictions": { "sift_prediction": null, "pp2_hvar_prediction": null, "cadd_prediction": 2.574395, "mutationtaster_prediction": null }, "status": "CU", "genomic_position_hg19": 8504907, "genomic_position_hg38": 8536866, "chromosome": "X", "annotation_flag": null, "lastmodified": "2023-06-06T16:57:53.839683", "ref_allele": "CT", "alt_allele": "C", "cdna_change": "c.1524delA", "protein_change": "p.Ser509ValfsTer40", "transcript_id": null, "dbsnp_id": "NA", "variant_effect": null }, "relationships": { "in_combination": { "meta": { "count": 1 }, "data": [ { "type": "Combination", "id": "OLI1016" } ], "links": { "self": "https://olida.ibsquare.be/api/variants/2202/relationships/in_combination?format=api", "related": "https://olida.ibsquare.be/api/variants/2202/combinations/?format=api" } }, "gene_name": { "links": { "self": "https://olida.ibsquare.be/api/variants/2202/relationships/gene_name?format=api", "related": "https://olida.ibsquare.be/api/variants/2202/gene/?format=api" }, "data": { "type": "Gene", "id": "ANOS1" } } }, "links": { "self": "https://olida.ibsquare.be/api/variants/2202/?format=api" } }, { "type": "SmallVariant", "id": "2395", "attributes": { "frequencies": { "KGP_genomes_maf": null, "KGP_genomes_AFR_maf": null, "KGP_genomes_AMR_maf": null, "KGP_genomes_EAS_maf": null, "KGP_genomes_EUR_maf": null, "KGP_genomes_SAS_maf": null, "gnomad_maf": null, "gnomad_AFR_maf": null, "gnomad_AMR_maf": null, "gnomad_ASJ_maf": null, "gnomad_EAS_maf": null, "gnomad_FIN_maf": null, "gnomad_NFE_maf": null, "gnomad_OTH_maf": null, "gnomad_SAS_maf": null, "ESP_AA_maf": null, "ESP_EA_maf": null }, "predictions": { "sift_prediction": null, "pp2_hvar_prediction": null, "cadd_prediction": 1.62829, "mutationtaster_prediction": null }, "status": "CU", "genomic_position_hg19": 8538536, "genomic_position_hg38": 8570495, "chromosome": "X", "annotation_flag": null, "lastmodified": "2023-06-06T16:57:55.008104", "ref_allele": "T", "alt_allele": "G", "cdna_change": "c.1062+4A>C", "protein_change": null, "transcript_id": "NM_000216", "dbsnp_id": "NA", "variant_effect": null }, "relationships": { "in_combination": { "meta": { "count": 1 }, "data": [ { "type": "Combination", "id": "OLI1106" } ], "links": { "self": "https://olida.ibsquare.be/api/variants/2395/relationships/in_combination?format=api", "related": "https://olida.ibsquare.be/api/variants/2395/combinations/?format=api" } }, "gene_name": { "links": { "self": "https://olida.ibsquare.be/api/variants/2395/relationships/gene_name?format=api", "related": "https://olida.ibsquare.be/api/variants/2395/gene/?format=api" }, "data": { "type": "Gene", "id": "ANOS1" } } }, "links": { "self": "https://olida.ibsquare.be/api/variants/2395/?format=api" } }, { "type": "SmallVariant", "id": "2405", "attributes": { "frequencies": { "KGP_genomes_maf": null, "KGP_genomes_AFR_maf": null, "KGP_genomes_AMR_maf": null, "KGP_genomes_EAS_maf": null, "KGP_genomes_EUR_maf": null, "KGP_genomes_SAS_maf": null, "gnomad_maf": null, "gnomad_AFR_maf": null, "gnomad_AMR_maf": null, "gnomad_ASJ_maf": null, "gnomad_EAS_maf": null, "gnomad_FIN_maf": null, "gnomad_NFE_maf": null, "gnomad_OTH_maf": null, "gnomad_SAS_maf": null, "ESP_AA_maf": null, "ESP_EA_maf": null }, "predictions": { "sift_prediction": null, "pp2_hvar_prediction": null, "cadd_prediction": 4.302589, "mutationtaster_prediction": null }, "status": "CU", "genomic_position_hg19": 8555996, "genomic_position_hg38": 8587955, "chromosome": "X", "annotation_flag": null, "lastmodified": "2023-06-06T16:57:55.070679", "ref_allele": "CTT", "alt_allele": "C", "cdna_change": "c.563_564delAA", "protein_change": "p.Lys188ArgfsTer15", "transcript_id": "NM_000216", "dbsnp_id": "NA", "variant_effect": null }, "relationships": { "in_combination": { "meta": { "count": 1 }, "data": [ { "type": "Combination", "id": "OLI1114" } ], "links": { "self": "https://olida.ibsquare.be/api/variants/2405/relationships/in_combination?format=api", "related": "https://olida.ibsquare.be/api/variants/2405/combinations/?format=api" } }, "gene_name": { "links": { "self": "https://olida.ibsquare.be/api/variants/2405/relationships/gene_name?format=api", "related": "https://olida.ibsquare.be/api/variants/2405/gene/?format=api" }, "data": { "type": "Gene", "id": "ANOS1" } } }, "links": { "self": "https://olida.ibsquare.be/api/variants/2405/?format=api" } }, { "type": "SmallVariant", "id": "2710", "attributes": { "frequencies": { "KGP_genomes_maf": null, "KGP_genomes_AFR_maf": null, "KGP_genomes_AMR_maf": null, "KGP_genomes_EAS_maf": null, "KGP_genomes_EUR_maf": null, "KGP_genomes_SAS_maf": null, "gnomad_maf": null, "gnomad_AFR_maf": null, "gnomad_AMR_maf": null, "gnomad_ASJ_maf": null, "gnomad_EAS_maf": null, "gnomad_FIN_maf": null, "gnomad_NFE_maf": null, "gnomad_OTH_maf": null, "gnomad_SAS_maf": null, "ESP_AA_maf": null, "ESP_EA_maf": null }, "predictions": { "sift_prediction": null, "pp2_hvar_prediction": null, "cadd_prediction": null, "mutationtaster_prediction": null }, "status": "CU", "genomic_position_hg19": 8667768, "genomic_position_hg38": 8699727, "chromosome": "X", "annotation_flag": null, "lastmodified": "2023-06-06T16:57:56.774727", "ref_allele": "CA", "alt_allele": "C", "cdna_change": "c.226delT", "protein_change": "p.Trp76GlyfsTer21", "transcript_id": "NM_000216.4", "dbsnp_id": "NA", "variant_effect": null }, "relationships": { "in_combination": { "meta": { "count": 1 }, "data": [ { "type": "Combination", "id": "OLI1287" } ], "links": { "self": "https://olida.ibsquare.be/api/variants/2710/relationships/in_combination?format=api", "related": "https://olida.ibsquare.be/api/variants/2710/combinations/?format=api" } }, "gene_name": { "links": { "self": "https://olida.ibsquare.be/api/variants/2710/relationships/gene_name?format=api", "related": "https://olida.ibsquare.be/api/variants/2710/gene/?format=api" }, "data": { "type": "Gene", "id": "ANOS1" } } }, "links": { "self": "https://olida.ibsquare.be/api/variants/2710/?format=api" } }, { "type": "SmallVariant", "id": "2727", "attributes": { "frequencies": { "KGP_genomes_maf": null, "KGP_genomes_AFR_maf": null, "KGP_genomes_AMR_maf": null, "KGP_genomes_EAS_maf": null, "KGP_genomes_EUR_maf": null, "KGP_genomes_SAS_maf": null, "gnomad_maf": null, "gnomad_AFR_maf": null, "gnomad_AMR_maf": null, "gnomad_ASJ_maf": null, "gnomad_EAS_maf": null, "gnomad_FIN_maf": null, "gnomad_NFE_maf": null, "gnomad_OTH_maf": null, "gnomad_SAS_maf": null, "ESP_AA_maf": null, "ESP_EA_maf": null }, "predictions": { "sift_prediction": null, "pp2_hvar_prediction": null, "cadd_prediction": 6.727119, "mutationtaster_prediction": "Disease causing" }, "status": "CU", "genomic_position_hg19": 8504965, "genomic_position_hg38": 8536924, "chromosome": "X", "annotation_flag": null, "lastmodified": "2023-06-06T16:57:56.877265", "ref_allele": "G", "alt_allele": "A", "cdna_change": "c.1468C>T", "protein_change": "p.Gln490Ter", "transcript_id": "NM_000216.4", "dbsnp_id": "NA", "variant_effect": null }, "relationships": { "in_combination": { "meta": { "count": 1 }, "data": [ { "type": "Combination", "id": "OLI1298" } ], "links": { "self": "https://olida.ibsquare.be/api/variants/2727/relationships/in_combination?format=api", "related": "https://olida.ibsquare.be/api/variants/2727/combinations/?format=api" } }, "gene_name": { "links": { "self": "https://olida.ibsquare.be/api/variants/2727/relationships/gene_name?format=api", "related": "https://olida.ibsquare.be/api/variants/2727/gene/?format=api" }, "data": { "type": "Gene", "id": "ANOS1" } } }, "links": { "self": "https://olida.ibsquare.be/api/variants/2727/?format=api" } }, { "type": "SmallVariant", "id": "2731", "attributes": { "frequencies": { "KGP_genomes_maf": null, "KGP_genomes_AFR_maf": null, "KGP_genomes_AMR_maf": null, "KGP_genomes_EAS_maf": null, "KGP_genomes_EUR_maf": null, "KGP_genomes_SAS_maf": null, "gnomad_maf": null, "gnomad_AFR_maf": null, "gnomad_AMR_maf": null, "gnomad_ASJ_maf": null, "gnomad_EAS_maf": null, "gnomad_FIN_maf": null, "gnomad_NFE_maf": null, "gnomad_OTH_maf": null, "gnomad_SAS_maf": null, "ESP_AA_maf": null, "ESP_EA_maf": null }, "predictions": { "sift_prediction": null, "pp2_hvar_prediction": null, "cadd_prediction": 5.898053, "mutationtaster_prediction": "Disease causing" }, "status": "CU", "genomic_position_hg19": 8555903, "genomic_position_hg38": 8587862, "chromosome": "X", "annotation_flag": null, "lastmodified": "2023-06-06T16:57:56.901453", "ref_allele": "G", "alt_allele": "A", "cdna_change": "c.658C>T", "protein_change": "p.Gln220Ter", "transcript_id": "NM_000216.4", "dbsnp_id": "NA", "variant_effect": null }, "relationships": { "in_combination": { "meta": { "count": 1 }, "data": [ { "type": "Combination", "id": "OLI1301" } ], "links": { "self": "https://olida.ibsquare.be/api/variants/2731/relationships/in_combination?format=api", "related": "https://olida.ibsquare.be/api/variants/2731/combinations/?format=api" } }, "gene_name": { "links": { "self": "https://olida.ibsquare.be/api/variants/2731/relationships/gene_name?format=api", "related": "https://olida.ibsquare.be/api/variants/2731/gene/?format=api" }, "data": { "type": "Gene", "id": "ANOS1" } } }, "links": { "self": "https://olida.ibsquare.be/api/variants/2731/?format=api" } }, { "type": "SmallVariant", "id": "2767", "attributes": { "frequencies": { "KGP_genomes_maf": null, "KGP_genomes_AFR_maf": null, "KGP_genomes_AMR_maf": null, "KGP_genomes_EAS_maf": null, "KGP_genomes_EUR_maf": null, "KGP_genomes_SAS_maf": null, "gnomad_maf": null, "gnomad_AFR_maf": null, "gnomad_AMR_maf": null, "gnomad_ASJ_maf": null, "gnomad_EAS_maf": null, "gnomad_FIN_maf": null, "gnomad_NFE_maf": null, "gnomad_OTH_maf": null, "gnomad_SAS_maf": null, "ESP_AA_maf": null, "ESP_EA_maf": null }, "predictions": { "sift_prediction": "Deleterious", "pp2_hvar_prediction": "Damaging", "cadd_prediction": 2.853315, "mutationtaster_prediction": "Polymorphism" }, "status": "CU", "genomic_position_hg19": 8502473, "genomic_position_hg38": 8534432, "chromosome": "X", "annotation_flag": null, "lastmodified": "2023-06-06T16:57:57.119336", "ref_allele": "A", "alt_allele": "C", "cdna_change": "c.1871T>G", "protein_change": "p.Leu624Arg", "transcript_id": null, "dbsnp_id": "NA", "variant_effect": null }, "relationships": { "in_combination": { "meta": { "count": 1 }, "data": [ { "type": "Combination", "id": "OLI1320" } ], "links": { "self": "https://olida.ibsquare.be/api/variants/2767/relationships/in_combination?format=api", "related": "https://olida.ibsquare.be/api/variants/2767/combinations/?format=api" } }, "gene_name": { "links": { "self": "https://olida.ibsquare.be/api/variants/2767/relationships/gene_name?format=api", "related": "https://olida.ibsquare.be/api/variants/2767/gene/?format=api" }, "data": { "type": "Gene", "id": "ANOS1" } } }, "links": { "self": "https://olida.ibsquare.be/api/variants/2767/?format=api" } }, { "type": "SmallVariant", "id": "2827", "attributes": { "frequencies": { "KGP_genomes_maf": null, "KGP_genomes_AFR_maf": null, "KGP_genomes_AMR_maf": null, "KGP_genomes_EAS_maf": null, "KGP_genomes_EUR_maf": null, "KGP_genomes_SAS_maf": null, "gnomad_maf": 0.0002522, "gnomad_AFR_maf": 0.0, "gnomad_AMR_maf": 3.653e-05, "gnomad_ASJ_maf": 0.0, "gnomad_EAS_maf": 0.0, "gnomad_FIN_maf": 0.002643, "gnomad_NFE_maf": 2.461e-05, "gnomad_OTH_maf": 0.0002215, "gnomad_SAS_maf": 0.0, "ESP_AA_maf": null, "ESP_EA_maf": null }, "predictions": { "sift_prediction": "Tolerated", "pp2_hvar_prediction": "Benign", "cadd_prediction": -0.870694, "mutationtaster_prediction": "Polymorphism" }, "status": "CU", "genomic_position_hg19": 8538695, "genomic_position_hg38": 8570654, "chromosome": "X", "annotation_flag": null, "lastmodified": "2023-06-06T16:57:57.478599", "ref_allele": "C", "alt_allele": "T", "cdna_change": "c.907G>A", "protein_change": "p.Val303Ile", "transcript_id": null, "dbsnp_id": "NA", "variant_effect": null }, "relationships": { "in_combination": { "meta": { "count": 1 }, "data": [ { "type": "Combination", "id": "OLI1339" } ], "links": { "self": "https://olida.ibsquare.be/api/variants/2827/relationships/in_combination?format=api", "related": "https://olida.ibsquare.be/api/variants/2827/combinations/?format=api" } }, "gene_name": { "links": { "self": "https://olida.ibsquare.be/api/variants/2827/relationships/gene_name?format=api", "related": "https://olida.ibsquare.be/api/variants/2827/gene/?format=api" }, "data": { "type": "Gene", "id": "ANOS1" } } }, "links": { "self": "https://olida.ibsquare.be/api/variants/2827/?format=api" } }, { "type": "SmallVariant", "id": "2916", "attributes": { "frequencies": { "KGP_genomes_maf": null, "KGP_genomes_AFR_maf": null, "KGP_genomes_AMR_maf": null, "KGP_genomes_EAS_maf": null, "KGP_genomes_EUR_maf": null, "KGP_genomes_SAS_maf": null, "gnomad_maf": null, "gnomad_AFR_maf": null, "gnomad_AMR_maf": null, "gnomad_ASJ_maf": null, "gnomad_EAS_maf": null, "gnomad_FIN_maf": null, "gnomad_NFE_maf": null, "gnomad_OTH_maf": null, "gnomad_SAS_maf": null, "ESP_AA_maf": null, "ESP_EA_maf": null }, "predictions": { "sift_prediction": null, "pp2_hvar_prediction": null, "cadd_prediction": 5.743525, "mutationtaster_prediction": "Disease causing" }, "status": "CU", "genomic_position_hg19": 8507785, "genomic_position_hg38": 8539744, "chromosome": "X", "annotation_flag": null, "lastmodified": "2023-06-06T16:57:58.007013", "ref_allele": "G", "alt_allele": "A", "cdna_change": "c.1369C>T", "protein_change": "p.Arg457Ter", "transcript_id": null, "dbsnp_id": "NA", "variant_effect": null }, "relationships": { "in_combination": { "meta": { "count": 1 }, "data": [ { "type": "Combination", "id": "OLI1390" } ], "links": { "self": "https://olida.ibsquare.be/api/variants/2916/relationships/in_combination?format=api", "related": "https://olida.ibsquare.be/api/variants/2916/combinations/?format=api" } }, "gene_name": { "links": { "self": "https://olida.ibsquare.be/api/variants/2916/relationships/gene_name?format=api", "related": "https://olida.ibsquare.be/api/variants/2916/gene/?format=api" }, "data": { "type": "Gene", "id": "ANOS1" } } }, "links": { "self": "https://olida.ibsquare.be/api/variants/2916/?format=api" } }, { "type": "SmallVariant", "id": "2947", "attributes": { "frequencies": { "KGP_genomes_maf": null, "KGP_genomes_AFR_maf": null, "KGP_genomes_AMR_maf": null, "KGP_genomes_EAS_maf": null, "KGP_genomes_EUR_maf": null, "KGP_genomes_SAS_maf": null, "gnomad_maf": null, "gnomad_AFR_maf": null, "gnomad_AMR_maf": null, "gnomad_ASJ_maf": null, "gnomad_EAS_maf": null, "gnomad_FIN_maf": null, "gnomad_NFE_maf": null, "gnomad_OTH_maf": null, "gnomad_SAS_maf": null, "ESP_AA_maf": null, "ESP_EA_maf": null }, "predictions": { "sift_prediction": null, "pp2_hvar_prediction": null, "cadd_prediction": 3.329057, "mutationtaster_prediction": "Disease causing" }, "status": "CU", "genomic_position_hg19": 8699985, "genomic_position_hg38": 8731944, "chromosome": "X", "annotation_flag": null, "lastmodified": "2023-06-06T16:57:58.194958", "ref_allele": "AGCAGCCGCGCCGGGGCCGGCCGCCAG", "alt_allele": "A", "cdna_change": "c.67_92del", "protein_change": "p.Leu23CysfsTer54", "transcript_id": null, "dbsnp_id": "NA", "variant_effect": null }, "relationships": { "in_combination": { "meta": { "count": 1 }, "data": [ { "type": "Combination", "id": "OLI1404" } ], "links": { "self": "https://olida.ibsquare.be/api/variants/2947/relationships/in_combination?format=api", "related": "https://olida.ibsquare.be/api/variants/2947/combinations/?format=api" } }, "gene_name": { "links": { "self": "https://olida.ibsquare.be/api/variants/2947/relationships/gene_name?format=api", "related": "https://olida.ibsquare.be/api/variants/2947/gene/?format=api" }, "data": { "type": "Gene", "id": "ANOS1" } } }, "links": { "self": "https://olida.ibsquare.be/api/variants/2947/?format=api" } }, { "type": "SmallVariant", "id": "2957", "attributes": { "frequencies": { "KGP_genomes_maf": null, "KGP_genomes_AFR_maf": null, "KGP_genomes_AMR_maf": null, "KGP_genomes_EAS_maf": null, "KGP_genomes_EUR_maf": null, "KGP_genomes_SAS_maf": null, "gnomad_maf": null, "gnomad_AFR_maf": null, "gnomad_AMR_maf": null, "gnomad_ASJ_maf": null, "gnomad_EAS_maf": null, "gnomad_FIN_maf": null, "gnomad_NFE_maf": null, "gnomad_OTH_maf": null, "gnomad_SAS_maf": null, "ESP_AA_maf": null, "ESP_EA_maf": null }, "predictions": { "sift_prediction": null, "pp2_hvar_prediction": null, "cadd_prediction": 2.447423, "mutationtaster_prediction": "Disease causing" }, "status": "CU", "genomic_position_hg19": 8503672, "genomic_position_hg38": 8535631, "chromosome": "X", "annotation_flag": null, "lastmodified": "2023-06-06T16:57:58.255887", "ref_allele": "AG", "alt_allele": "A", "cdna_change": "c.1801del", "protein_change": "p.Leu601TyrfsTer19", "transcript_id": null, "dbsnp_id": "NA", "variant_effect": null }, "relationships": { "in_combination": { "meta": { "count": 1 }, "data": [ { "type": "Combination", "id": "OLI1407" } ], "links": { "self": "https://olida.ibsquare.be/api/variants/2957/relationships/in_combination?format=api", "related": "https://olida.ibsquare.be/api/variants/2957/combinations/?format=api" } }, "gene_name": { "links": { "self": "https://olida.ibsquare.be/api/variants/2957/relationships/gene_name?format=api", "related": "https://olida.ibsquare.be/api/variants/2957/gene/?format=api" }, "data": { "type": "Gene", "id": "ANOS1" } } }, "links": { "self": "https://olida.ibsquare.be/api/variants/2957/?format=api" } }, { "type": "SmallVariant", "id": "2962", "attributes": { "frequencies": { "KGP_genomes_maf": null, "KGP_genomes_AFR_maf": null, "KGP_genomes_AMR_maf": null, "KGP_genomes_EAS_maf": null, "KGP_genomes_EUR_maf": null, "KGP_genomes_SAS_maf": null, "gnomad_maf": null, "gnomad_AFR_maf": null, "gnomad_AMR_maf": null, "gnomad_ASJ_maf": null, "gnomad_EAS_maf": null, "gnomad_FIN_maf": null, "gnomad_NFE_maf": null, "gnomad_OTH_maf": null, "gnomad_SAS_maf": null, "ESP_AA_maf": null, "ESP_EA_maf": null }, "predictions": { "sift_prediction": null, "pp2_hvar_prediction": null, "cadd_prediction": 3.312631, "mutationtaster_prediction": "Disease causing" }, "status": "CU", "genomic_position_hg19": 8507704, "genomic_position_hg38": 8539663, "chromosome": "X", "annotation_flag": null, "lastmodified": "2023-06-06T16:57:58.286203", "ref_allele": "C", "alt_allele": "T", "cdna_change": "c.1449+1G>A", "protein_change": null, "transcript_id": null, "dbsnp_id": "NA", "variant_effect": null }, "relationships": { "in_combination": { "meta": { "count": 2 }, "data": [ { "type": "Combination", "id": "OLI1409" }, { "type": "Combination", "id": "OLI1420" } ], "links": { "self": "https://olida.ibsquare.be/api/variants/2962/relationships/in_combination?format=api", "related": "https://olida.ibsquare.be/api/variants/2962/combinations/?format=api" } }, "gene_name": { "links": { "self": "https://olida.ibsquare.be/api/variants/2962/relationships/gene_name?format=api", "related": "https://olida.ibsquare.be/api/variants/2962/gene/?format=api" }, "data": { "type": "Gene", "id": "ANOS1" } } }, "links": { "self": "https://olida.ibsquare.be/api/variants/2962/?format=api" } }, { "type": "SmallVariant", "id": "2966", "attributes": { "frequencies": { "KGP_genomes_maf": null, "KGP_genomes_AFR_maf": null, "KGP_genomes_AMR_maf": null, "KGP_genomes_EAS_maf": null, "KGP_genomes_EUR_maf": null, "KGP_genomes_SAS_maf": null, "gnomad_maf": null, "gnomad_AFR_maf": null, "gnomad_AMR_maf": null, "gnomad_ASJ_maf": null, "gnomad_EAS_maf": null, "gnomad_FIN_maf": null, "gnomad_NFE_maf": null, "gnomad_OTH_maf": null, "gnomad_SAS_maf": null, "ESP_AA_maf": null, "ESP_EA_maf": null }, "predictions": { "sift_prediction": null, "pp2_hvar_prediction": null, "cadd_prediction": null, "mutationtaster_prediction": null }, "status": "CU", "genomic_position_hg19": 8502457, "genomic_position_hg38": 8534416, "chromosome": "X", "annotation_flag": null, "lastmodified": "2023-06-06T16:57:58.310660", "ref_allele": "AAA", "alt_allele": "A", "cdna_change": "c.1887_1888del", "protein_change": "p.Tyr630ProfsTer36", "transcript_id": null, "dbsnp_id": "NA", "variant_effect": null }, "relationships": { "in_combination": { "meta": { "count": 1 }, "data": [ { "type": "Combination", "id": "OLI1411" } ], "links": { "self": "https://olida.ibsquare.be/api/variants/2966/relationships/in_combination?format=api", "related": "https://olida.ibsquare.be/api/variants/2966/combinations/?format=api" } }, "gene_name": { "links": { "self": "https://olida.ibsquare.be/api/variants/2966/relationships/gene_name?format=api", "related": "https://olida.ibsquare.be/api/variants/2966/gene/?format=api" }, "data": { "type": "Gene", "id": "ANOS1" } } }, "links": { "self": "https://olida.ibsquare.be/api/variants/2966/?format=api" } }, { "type": "SmallVariant", "id": "2987", "attributes": { "frequencies": { "KGP_genomes_maf": 0.0008, "KGP_genomes_AFR_maf": 0.0, "KGP_genomes_AMR_maf": 0.0014, "KGP_genomes_EAS_maf": 0.0, "KGP_genomes_EUR_maf": 0.003, "KGP_genomes_SAS_maf": 0.0, "gnomad_maf": 0.0005185, "gnomad_AFR_maf": 0.0003765, "gnomad_AMR_maf": 0.0005181, "gnomad_ASJ_maf": 0.002452, "gnomad_EAS_maf": 0.0, "gnomad_FIN_maf": 0.0, "gnomad_NFE_maf": 0.0006839, "gnomad_OTH_maf": 0.0005167, "gnomad_SAS_maf": 0.0, "ESP_AA_maf": null, "ESP_EA_maf": null }, "predictions": { "sift_prediction": "Tolerated", "pp2_hvar_prediction": "Benign", "cadd_prediction": 2.227806, "mutationtaster_prediction": "Polymorphism" }, "status": "CU", "genomic_position_hg19": 139931691, "genomic_position_hg38": 140552106, "chromosome": "5", "annotation_flag": null, "lastmodified": "2023-06-06T16:57:58.441294", "ref_allele": "G", "alt_allele": "A", "cdna_change": "c.266C>T", "protein_change": "p.Pro89Leu", "transcript_id": "NM_001035235.3", "dbsnp_id": "NA", "variant_effect": null }, "relationships": { "in_combination": { "meta": { "count": 1 }, "data": [ { "type": "Combination", "id": "OLI1421" } ], "links": { "self": "https://olida.ibsquare.be/api/variants/2987/relationships/in_combination?format=api", "related": "https://olida.ibsquare.be/api/variants/2987/combinations/?format=api" } }, "gene_name": { "links": { "self": "https://olida.ibsquare.be/api/variants/2987/relationships/gene_name?format=api", "related": "https://olida.ibsquare.be/api/variants/2987/gene/?format=api" }, "data": { "type": "Gene", "id": "ANOS1" } } }, "links": { "self": "https://olida.ibsquare.be/api/variants/2987/?format=api" } }, { "type": "SmallVariant", "id": "2988", "attributes": { "frequencies": { "KGP_genomes_maf": null, "KGP_genomes_AFR_maf": null, "KGP_genomes_AMR_maf": null, "KGP_genomes_EAS_maf": null, "KGP_genomes_EUR_maf": null, "KGP_genomes_SAS_maf": null, "gnomad_maf": null, "gnomad_AFR_maf": null, "gnomad_AMR_maf": null, "gnomad_ASJ_maf": null, "gnomad_EAS_maf": null, "gnomad_FIN_maf": null, "gnomad_NFE_maf": null, "gnomad_OTH_maf": null, "gnomad_SAS_maf": null, "ESP_AA_maf": null, "ESP_EA_maf": null }, "predictions": { "sift_prediction": null, "pp2_hvar_prediction": null, "cadd_prediction": 6.18056, "mutationtaster_prediction": "Disease causing" }, "status": "CU", "genomic_position_hg19": 8553350, "genomic_position_hg38": 8585309, "chromosome": "X", "annotation_flag": null, "lastmodified": "2023-06-06T16:57:58.447373", "ref_allele": "G", "alt_allele": "A", "cdna_change": "c.814C>T", "protein_change": "p.Arg272Ter", "transcript_id": null, "dbsnp_id": "NA", "variant_effect": null }, "relationships": { "in_combination": { "meta": { "count": 1 }, "data": [ { "type": "Combination", "id": "OLI1422" } ], "links": { "self": "https://olida.ibsquare.be/api/variants/2988/relationships/in_combination?format=api", "related": "https://olida.ibsquare.be/api/variants/2988/combinations/?format=api" } }, "gene_name": { "links": { "self": "https://olida.ibsquare.be/api/variants/2988/relationships/gene_name?format=api", "related": "https://olida.ibsquare.be/api/variants/2988/gene/?format=api" }, "data": { "type": "Gene", "id": "ANOS1" } } }, "links": { "self": "https://olida.ibsquare.be/api/variants/2988/?format=api" } }, { "type": "SmallVariant", "id": "2993", "attributes": { "frequencies": { "KGP_genomes_maf": null, "KGP_genomes_AFR_maf": null, "KGP_genomes_AMR_maf": null, "KGP_genomes_EAS_maf": null, "KGP_genomes_EUR_maf": null, "KGP_genomes_SAS_maf": null, "gnomad_maf": null, "gnomad_AFR_maf": null, "gnomad_AMR_maf": null, "gnomad_ASJ_maf": null, "gnomad_EAS_maf": null, "gnomad_FIN_maf": null, "gnomad_NFE_maf": null, "gnomad_OTH_maf": null, "gnomad_SAS_maf": null, "ESP_AA_maf": null, "ESP_EA_maf": null }, "predictions": { "sift_prediction": null, "pp2_hvar_prediction": null, "cadd_prediction": 3.846257, "mutationtaster_prediction": null }, "status": "CU", "genomic_position_hg19": 8507772, "genomic_position_hg38": 8539731, "chromosome": "X", "annotation_flag": null, "lastmodified": "2023-06-06T16:57:58.477766", "ref_allele": "CG", "alt_allele": "C", "cdna_change": "c.1381delC", "protein_change": "p.Arg461GlyfsTer21", "transcript_id": null, "dbsnp_id": "NA", "variant_effect": null }, "relationships": { "in_combination": { "meta": { "count": 1 }, "data": [ { "type": "Combination", "id": "OLI1424" } ], "links": { "self": "https://olida.ibsquare.be/api/variants/2993/relationships/in_combination?format=api", "related": "https://olida.ibsquare.be/api/variants/2993/combinations/?format=api" } }, "gene_name": { "links": { "self": "https://olida.ibsquare.be/api/variants/2993/relationships/gene_name?format=api", "related": "https://olida.ibsquare.be/api/variants/2993/gene/?format=api" }, "data": { "type": "Gene", "id": "ANOS1" } } }, "links": { "self": "https://olida.ibsquare.be/api/variants/2993/?format=api" } }, { "type": "SmallVariant", "id": "2997", "attributes": { "frequencies": { "KGP_genomes_maf": null, "KGP_genomes_AFR_maf": null, "KGP_genomes_AMR_maf": null, "KGP_genomes_EAS_maf": null, "KGP_genomes_EUR_maf": null, "KGP_genomes_SAS_maf": null, "gnomad_maf": 5.466e-06, "gnomad_AFR_maf": 0.0, "gnomad_AMR_maf": 3.65e-05, "gnomad_ASJ_maf": 0.0, "gnomad_EAS_maf": 0.0, "gnomad_FIN_maf": 0.0, "gnomad_NFE_maf": 0.0, "gnomad_OTH_maf": 0.0, "gnomad_SAS_maf": 0.0, "ESP_AA_maf": null, "ESP_EA_maf": null }, "predictions": { "sift_prediction": null, "pp2_hvar_prediction": null, "cadd_prediction": 6.195363, "mutationtaster_prediction": "Disease causing" }, "status": "CU", "genomic_position_hg19": 8522077, "genomic_position_hg38": 8554036, "chromosome": "X", "annotation_flag": null, "lastmodified": "2023-06-06T16:57:58.501820", "ref_allele": "G", "alt_allele": "A", "cdna_change": "c.1270C>T", "protein_change": "p.Arg424Ter", "transcript_id": null, "dbsnp_id": "NA", "variant_effect": null }, "relationships": { "in_combination": { "meta": { "count": 1 }, "data": [ { "type": "Combination", "id": "OLI1425" } ], "links": { "self": "https://olida.ibsquare.be/api/variants/2997/relationships/in_combination?format=api", "related": "https://olida.ibsquare.be/api/variants/2997/combinations/?format=api" } }, "gene_name": { "links": { "self": "https://olida.ibsquare.be/api/variants/2997/relationships/gene_name?format=api", "related": "https://olida.ibsquare.be/api/variants/2997/gene/?format=api" }, "data": { "type": "Gene", "id": "ANOS1" } } }, "links": { "self": "https://olida.ibsquare.be/api/variants/2997/?format=api" } }, { "type": "SmallVariant", "id": "3158", "attributes": { "frequencies": { "KGP_genomes_maf": 0.0005, "KGP_genomes_AFR_maf": 0.0, "KGP_genomes_AMR_maf": 0.0038, "KGP_genomes_EAS_maf": 0.0, "KGP_genomes_EUR_maf": 0.0, "KGP_genomes_SAS_maf": 0.0, "gnomad_maf": 0.0002917, "gnomad_AFR_maf": 0.0, "gnomad_AMR_maf": 0.0003658, "gnomad_ASJ_maf": 0.004029, "gnomad_EAS_maf": 7.254e-05, "gnomad_FIN_maf": 6.303e-05, "gnomad_NFE_maf": 8.655e-05, "gnomad_OTH_maf": 0.0004446, "gnomad_SAS_maf": 0.0001064, "ESP_AA_maf": null, "ESP_EA_maf": null }, "predictions": { "sift_prediction": "Deleterious", "pp2_hvar_prediction": "Benign", "cadd_prediction": 1.647021, "mutationtaster_prediction": "Disease causing" }, "status": "CU", "genomic_position_hg19": 8536293, "genomic_position_hg38": 8568252, "chromosome": "X", "annotation_flag": null, "lastmodified": "2023-06-06T16:57:59.431167", "ref_allele": "G", "alt_allele": "A", "cdna_change": "c.1187C>T", "protein_change": "p.Ser396Leu", "transcript_id": "NM_000216", "dbsnp_id": "NA", "variant_effect": null }, "relationships": { "in_combination": { "meta": { "count": 2 }, "data": [ { "type": "Combination", "id": "OLI1509" }, { "type": "Combination", "id": "OLI1544" } ], "links": { "self": "https://olida.ibsquare.be/api/variants/3158/relationships/in_combination?format=api", "related": "https://olida.ibsquare.be/api/variants/3158/combinations/?format=api" } }, "gene_name": { "links": { "self": "https://olida.ibsquare.be/api/variants/3158/relationships/gene_name?format=api", "related": "https://olida.ibsquare.be/api/variants/3158/gene/?format=api" }, "data": { "type": "Gene", "id": "ANOS1" } } }, "links": { "self": "https://olida.ibsquare.be/api/variants/3158/?format=api" } } ], "meta": { "database_name": "OLIgogenic diseases DAtabase (OLIDA)", "resource_url": "olida.ibsquare.be", "api_release_year": "2021", "api_developer": [ [ "Arnau Dillen", "arnau.dillen@ulb.ac.be" ], [ "Charlotte Nachtegael", "charlotte.nachtegael@ulb.be" ] ], "api_version": "0.3", "api_maintainers": [ [ "Charlotte Nachtegael", "charlotte.nachtegael@ulb.be" ] ], "api_documentation": [ "olida.ibsquare.be/api/swagger", "olida.ibsquare.be/api/redoc" ], "copyright": "Copyright (c) 2026 · OLIDA All Rights Reserved.", "license": "CC Attribution-NonCommercial 4.0 International License", "ontologies": { "ORDO": "http://bioportal.bioontology.org/ontologies/ORDO", "GENO": "http://purl.obolibrary.org/obo/geno.owl", "MI": "http://purl.obolibrary.org/obo/mi.owl", "NCIT": "http://purl.obolibrary.org/obo/ncit.owl", "OGI": "http://purl.obolibrary.org/obo/ogi.owl", "OGG": "http://purl.obolibrary.org/obo/ogg.owl" }, "relevant_publications_doi": [ "10.1093/nar/gkv1068", "10.1093/database/baac023" ], "Variant serializers": [ "SmallVariantSerializer", "CopyNumberVariantSerializer" ], "size": 36 } }