Variant List
This API endpoint handles listing (/variants) and retrieval (/variants/<ID>/) of genetic variants from the database
GET /api/combinations/OLI1404/variants/?format=api
{ "data": [ { "type": "SmallVariant", "id": "2947", "attributes": { "frequencies": { "KGP_genomes_maf": null, "KGP_genomes_AFR_maf": null, "KGP_genomes_AMR_maf": null, "KGP_genomes_EAS_maf": null, "KGP_genomes_EUR_maf": null, "KGP_genomes_SAS_maf": null, "gnomad_maf": null, "gnomad_AFR_maf": null, "gnomad_AMR_maf": null, "gnomad_ASJ_maf": null, "gnomad_EAS_maf": null, "gnomad_FIN_maf": null, "gnomad_NFE_maf": null, "gnomad_OTH_maf": null, "gnomad_SAS_maf": null, "ESP_AA_maf": null, "ESP_EA_maf": null }, "predictions": { "sift_prediction": null, "pp2_hvar_prediction": null, "cadd_prediction": 3.329057, "mutationtaster_prediction": "Disease causing" }, "status": "CU", "genomic_position_hg19": 8699985, "genomic_position_hg38": 8731944, "chromosome": "X", "annotation_flag": null, "lastmodified": "2023-06-06T16:57:58.194958", "ref_allele": "AGCAGCCGCGCCGGGGCCGGCCGCCAG", "alt_allele": "A", "cdna_change": "c.67_92del", "protein_change": "p.Leu23CysfsTer54", "transcript_id": null, "dbsnp_id": "NA", "variant_effect": null }, "relationships": { "in_combination": { "meta": { "count": 1 }, "data": [ { "type": "Combination", "id": "OLI1404" } ], "links": { "self": "https://olida.ibsquare.be/api/variants/2947/relationships/in_combination?format=api", "related": "https://olida.ibsquare.be/api/variants/2947/combinations/?format=api" } }, "gene_name": { "links": { "self": "https://olida.ibsquare.be/api/variants/2947/relationships/gene_name?format=api", "related": "https://olida.ibsquare.be/api/variants/2947/gene/?format=api" }, "data": { "type": "Gene", "id": "ANOS1" } } }, "links": { "self": "https://olida.ibsquare.be/api/variants/2947/?format=api" } }, { "type": "SmallVariant", "id": "2948", "attributes": { "frequencies": { "KGP_genomes_maf": null, "KGP_genomes_AFR_maf": null, "KGP_genomes_AMR_maf": null, "KGP_genomes_EAS_maf": null, "KGP_genomes_EUR_maf": null, "KGP_genomes_SAS_maf": null, "gnomad_maf": 8.053e-06, "gnomad_AFR_maf": 0.0, "gnomad_AMR_maf": 0.0, "gnomad_ASJ_maf": 0.0, "gnomad_EAS_maf": 0.0, "gnomad_FIN_maf": 0.0, "gnomad_NFE_maf": 1.779e-05, "gnomad_OTH_maf": 0.0, "gnomad_SAS_maf": 0.0, "ESP_AA_maf": null, "ESP_EA_maf": null }, "predictions": { "sift_prediction": null, "pp2_hvar_prediction": null, "cadd_prediction": 6.31304, "mutationtaster_prediction": "Disease causing" }, "status": "CU", "genomic_position_hg19": 25279109, "genomic_position_hg38": 25421593, "chromosome": "8", "annotation_flag": null, "lastmodified": "2023-06-06T16:57:58.200982", "ref_allele": "G", "alt_allele": "A", "cdna_change": "c.229C>T", "protein_change": "p.Arg77Ter", "transcript_id": null, "dbsnp_id": "NA", "variant_effect": null }, "relationships": { "in_combination": { "meta": { "count": 1 }, "data": [ { "type": "Combination", "id": "OLI1404" } ], "links": { "self": "https://olida.ibsquare.be/api/variants/2948/relationships/in_combination?format=api", "related": "https://olida.ibsquare.be/api/variants/2948/combinations/?format=api" } }, "gene_name": { "links": { "self": "https://olida.ibsquare.be/api/variants/2948/relationships/gene_name?format=api", "related": "https://olida.ibsquare.be/api/variants/2948/gene/?format=api" }, "data": { "type": "Gene", "id": "GNRH1" } } }, "links": { "self": "https://olida.ibsquare.be/api/variants/2948/?format=api" } }, { "type": "SmallVariant", "id": "2949", "attributes": { "frequencies": { "KGP_genomes_maf": null, "KGP_genomes_AFR_maf": null, "KGP_genomes_AMR_maf": null, "KGP_genomes_EAS_maf": null, "KGP_genomes_EUR_maf": null, "KGP_genomes_SAS_maf": null, "gnomad_maf": 2.388e-05, "gnomad_AFR_maf": 6.152e-05, "gnomad_AMR_maf": 0.0, "gnomad_ASJ_maf": 9.925e-05, "gnomad_EAS_maf": 5.443e-05, "gnomad_FIN_maf": 0.0, "gnomad_NFE_maf": 2.641e-05, "gnomad_OTH_maf": 0.0, "gnomad_SAS_maf": 0.0, "ESP_AA_maf": null, "ESP_EA_maf": null }, "predictions": { "sift_prediction": "Deleterious", "pp2_hvar_prediction": "Possibly Damaging", "cadd_prediction": 4.3247, "mutationtaster_prediction": "Disease causing" }, "status": "CU", "genomic_position_hg19": 50866185, "genomic_position_hg38": 53339815, "chromosome": "18", "annotation_flag": null, "lastmodified": "2023-06-06T16:57:58.207025", "ref_allele": "G", "alt_allele": "A", "cdna_change": "c.2267G>A", "protein_change": "p.Arg756Gln", "transcript_id": null, "dbsnp_id": "NA", "variant_effect": null }, "relationships": { "in_combination": { "meta": { "count": 1 }, "data": [ { "type": "Combination", "id": "OLI1404" } ], "links": { "self": "https://olida.ibsquare.be/api/variants/2949/relationships/in_combination?format=api", "related": "https://olida.ibsquare.be/api/variants/2949/combinations/?format=api" } }, "gene_name": { "links": { "self": "https://olida.ibsquare.be/api/variants/2949/relationships/gene_name?format=api", "related": "https://olida.ibsquare.be/api/variants/2949/gene/?format=api" }, "data": { "type": "Gene", "id": "DCC" } } }, "links": { "self": "https://olida.ibsquare.be/api/variants/2949/?format=api" } }, { "type": "SmallVariant", "id": "2950", "attributes": { "frequencies": { "KGP_genomes_maf": null, "KGP_genomes_AFR_maf": null, "KGP_genomes_AMR_maf": null, "KGP_genomes_EAS_maf": null, "KGP_genomes_EUR_maf": null, "KGP_genomes_SAS_maf": null, "gnomad_maf": 7.976e-05, "gnomad_AFR_maf": 0.0, "gnomad_AMR_maf": 0.0, "gnomad_ASJ_maf": 0.0, "gnomad_EAS_maf": 0.0, "gnomad_FIN_maf": 0.000925, "gnomad_NFE_maf": 0.0, "gnomad_OTH_maf": 0.0, "gnomad_SAS_maf": 0.0, "ESP_AA_maf": null, "ESP_EA_maf": null }, "predictions": { "sift_prediction": "Tolerated", "pp2_hvar_prediction": "Benign", "cadd_prediction": -1.01474, "mutationtaster_prediction": "Polymorphism" }, "status": "CU", "genomic_position_hg19": 179742788, "genomic_position_hg38": 178878061, "chromosome": "2", "annotation_flag": null, "lastmodified": "2023-06-06T16:57:58.213088", "ref_allele": "T", "alt_allele": "A", "cdna_change": "c.1802A>T", "protein_change": "p.His601Leu", "transcript_id": null, "dbsnp_id": "NA", "variant_effect": null }, "relationships": { "in_combination": { "meta": { "count": 1 }, "data": [ { "type": "Combination", "id": "OLI1404" } ], "links": { "self": "https://olida.ibsquare.be/api/variants/2950/relationships/in_combination?format=api", "related": "https://olida.ibsquare.be/api/variants/2950/combinations/?format=api" } }, "gene_name": { "links": { "self": "https://olida.ibsquare.be/api/variants/2950/relationships/gene_name?format=api", "related": "https://olida.ibsquare.be/api/variants/2950/gene/?format=api" }, "data": { "type": "Gene", "id": "CCDC141" } } }, "links": { "self": "https://olida.ibsquare.be/api/variants/2950/?format=api" } } ], "meta": { "database_name": "OLIgogenic diseases DAtabase (OLIDA)", "resource_url": "olida.ibsquare.be", "api_release_year": "2021", "api_developer": [ [ "Arnau Dillen", "arnau.dillen@ulb.ac.be" ], [ "Charlotte Nachtegael", "charlotte.nachtegael@ulb.be" ] ], "api_version": "0.3", "api_maintainers": [ [ "Charlotte Nachtegael", "charlotte.nachtegael@ulb.be" ] ], "api_documentation": [ "olida.ibsquare.be/api/swagger", "olida.ibsquare.be/api/redoc" ], "copyright": "Copyright (c) 2025 · OLIDA All Rights Reserved.", "license": "CC Attribution-NonCommercial 4.0 International License", "ontologies": { "ORDO": "http://bioportal.bioontology.org/ontologies/ORDO", "GENO": "http://purl.obolibrary.org/obo/geno.owl", "MI": "http://purl.obolibrary.org/obo/mi.owl", "NCIT": "http://purl.obolibrary.org/obo/ncit.owl", "OGI": "http://purl.obolibrary.org/obo/ogi.owl", "OGG": "http://purl.obolibrary.org/obo/ogg.owl" }, "relevant_publications_doi": [ "10.1093/nar/gkv1068", "10.1093/database/baac023" ], "Variant serializers": [ "SmallVariantSerializer", "CopyNumberVariantSerializer" ], "size": 4 } }